diff --git a/Metagenomics/Illumina/Pipeline_GL-DPPD-7107_Versions/GL-DPPD-7107-A.md b/Metagenomics/Illumina/Pipeline_GL-DPPD-7107_Versions/GL-DPPD-7107-A.md new file mode 100644 index 000000000..31f6eaf92 --- /dev/null +++ b/Metagenomics/Illumina/Pipeline_GL-DPPD-7107_Versions/GL-DPPD-7107-A.md @@ -0,0 +1,1216 @@ +# Bioinformatics pipeline for Illumina metagenomics data + +> **This document holds an overview and some example commands of how GeneLab processes Illumina metagenomics datasets. Exact processing commands for specific datasets that have been released are provided with their processed data in the [Open Science Data Repository (OSDR)](https://osdr.nasa.gov/bio/repo/).** + +--- + +**Date:** October 28, 2024 +**Revision:** -A +**Document Number:** GL-DPPD-7107 + +**Submitted by:** +Olabiyi A. Obayomi (GeneLab Analysis Team) + +**Approved by:** +Samrawit Gebre (OSDR Project Manager) +Lauren Sanders (OSDR Project Scientist) +Amanda Saravia-Butler (GeneLab Science Lead) +Barbara Novak (GeneLab Data Processing Lead) + +--- + +## Updates from previous version + +- The following tool versions were updated: + - FastQC + - MultiQC + - bowtie2 + - samtools + - CAT + - GTDB-Tk + - HUMAnN + - MetaPhlAn +- In [step 14d](#14d-mag-taxonomic-classification), MAG taxonomic classification, added the new `--skip_ani_screen` argument to `gtdbtk classify_wf` to continue classifying genomes as in previous versions of GTDB-Tk, using mash and skani. + +--- + +# Table of contents + +- [**Software used**](#software-used) +- [**General processing overview with example commands**](#general-processing-overview-with-example-commands) + - [**Pre-processing**](#pre-processing) + - [1. Raw Data QC](#1-raw-data-qc) + - [2. Quality filtering/trimming](#2-quality-filteringtrimming) + - [3. Filtered/Trimmed Data QC](#3-filteredtrimmed-data-qc) + - [**Assembly-based processing**](#assembly-based-processing) + - [4. Sample assembly](#4-sample-assembly) + - [5. Renaming contigs and summarizing assemblies](#5-renaming-contigs-and-summarizing-assemblies) + - [6. Gene prediction](#6-gene-prediction) + - [7. Functional annotation](#7-functional-annotation) + - [8. Taxonomic classification](#8-taxonomic-classification) + - [9. Read-mapping](#9-read-mapping) + - [10. Getting coverage information and filtering based on detection](#10-getting-coverage-information-and-filtering-based-on-detection) + - [11. Combining gene-level coverage, taxonomy, and functional annotations into one table for each sample](#11-combining-gene-level-coverage-taxonomy-and-functional-annotations-into-one-table-for-each-sample) + - [12. Combining contig-level coverage and taxonomy into one table for each sample](#12-combining-contig-level-coverage-and-taxonomy-into-one-table-for-each-sample) + - [13. Generating normalized, gene- and contig-level coverage summary tables of KO-annotations and taxonomy across samples](#13-generating-normalized-gene--and-contig-level-coverage-summary-tables-of-ko-annotations-and-taxonomy-across-samples) + - [14. **M**etagenome-**A**ssembled **G**enome (MAG) recovery](#14-metagenome-assembled-genome-mag-recovery) + - [15. Generating MAG-level functional summary overview](#15-generating-mag-level-functional-summary-overview) + - [**Read-based processing**](#read-based-processing) + - [16. Taxonomic and functional profiling](#16-taxonomic-and-functional-profiling) + +--- + +# Software used + +|Program|Version|Relevant Links| +|:------|:-----:|------:| +|FastQC| 0.12.1 |[https://www.bioinformatics.babraham.ac.uk/projects/fastqc/](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/)| +|MultiQC| 1.19 |[https://multiqc.info/](https://multiqc.info/)| +|bbduk| 38.86 |[https://jgi.doe.gov/data-and-tools/software-tools/bbtools/bb-tools-user-guide/](https://jgi.doe.gov/data-and-tools/software-tools/bbtools/bb-tools-user-guide/)| +|MEGAHIT| 1.2.9 |[https://github.com/voutcn/megahit#megahit](https://github.com/voutcn/megahit#megahit)| +|bit| 1.8.53 |[https://github.com/AstrobioMike/bioinf_tools#bioinformatics-tools-bit](https://github.com/AstrobioMike/bioinf_tools#bioinformatics-tools-bit)| +|bowtie2| 2.4.1 |[https://github.com/BenLangmead/bowtie2#overview](https://github.com/BenLangmead/bowtie2#overview)| +|samtools| 1.20 |[https://github.com/samtools/samtools#samtools](https://github.com/samtools/samtools#samtools)| +|Prodigal| 2.6.3 |[https://github.com/hyattpd/Prodigal#prodigal](https://github.com/hyattpd/Prodigal#prodigal)| +|KOFamScan| 1.3.0 |[https://github.com/takaram/kofam_scan#kofamscan](https://github.com/takaram/kofam_scan#kofamscan)| +|CAT| 5.2.3 |[https://github.com/dutilh/CAT#cat-and-bat](https://github.com/dutilh/CAT#cat-and-bat)| +|MetaBAT| 2.15 |[https://bitbucket.org/berkeleylab/metabat/src/master/](https://bitbucket.org/berkeleylab/metabat/src/master/)| +|CheckM| 1.1.3 |[https://github.com/Ecogenomics/CheckM](https://github.com/Ecogenomics/CheckM)| +|GTDB-Tk| 2.4.0 |[https://github.com/Ecogenomics/GTDBTk](https://github.com/Ecogenomics/GTDBTk)| +|KEGG-Decoder| 1.2.2 |[https://github.com/bjtully/BioData/tree/master/KEGGDecoder#kegg-decoder](https://github.com/bjtully/BioData/tree/master/KEGGDecoder#kegg-decoder) +|HUMAnN| 3.9 |[https://github.com/biobakery/humann](https://github.com/biobakery/humann)| +|MetaPhlAn| 4.1.0 |[https://github.com/biobakery/MetaPhlAn](https://github.com/biobakery/MetaPhlAn)| + +--- + +# General processing overview with example commands + +> Exact processing commands and output files listed in **bold** below are included with each Metagenomics Seq processed dataset in the [Open Science Data Repository (OSDR)](https://osdr.nasa.gov/bio/repo/). + +## Pre-processing +### 1. Raw Data QC + +``` +fastqc -o raw_fastqc_output *raw.fastq.gz +``` + +**Parameter Definitions:** + +* `-o` – the output directory to store results +* `*raw.fastq.gz` – the input reads are specified as a positional argument, and can be given all at once with wildcards like this, or as individual arguments with spaces in between them + +**Input data:** + +* *raw.fastq.gz (raw reads, after human read removal) + +**Output data:** + +* *fastqc.html (FastQC output html summary) +* *fastqc.zip (FastQC output data) + + +#### 1a. Compile Raw Data QC + +``` +multiqc -o raw_multiqc_output -n raw_multiqc raw_fastqc_output/ +# this is how it's packaged with our workflow outputs +zip -r raw_multiqc_GLmetagenomics_report.zip raw_multiqc_output +``` + +**Parameter Definitions:** + +* `-o` – the output directory to store results +* `-n` – the filename prefix of results +* `raw_fastqc_output/` – the directory holding the output data from the fastqc run, provided as a positional argument + +**Input data:** + +* raw_fastqc_output/*fastqc.zip (FastQC output data) + +**Output data:** + +* **raw_multiqc_GLmetagenomics_report.zip** (zip containing the following) + * **raw_multiqc.html** (multiqc output html summary) + * **raw_multiqc_data** (directory containing multiqc output data) + +
+ +--- + +### 2. Quality filtering/trimming + +``` +bbduk.sh in=sample-1-R1-raw.fastq.gz in2=sample-1-R2-raw.fastq.gz out1=sample-1_R1_filtered.fastq.gz \ + out2=sample-1_R2_filtered.fastq.gz ref=ref-adapters.fa ktrim=l k=17 ftm=5 qtrim=rl \ + trimq=10 mlf=0.5 maxns=0 > bbduk.log 2>&1 + +# if libraries were prepared with the Swift1S kit +# bbduk.sh in=sample-1-R1-raw.fastq.gz in2=sample-1-R2-raw.fastq.gz out1=sample-1_R1_filtered.fastq.gz \ + out2=sample-1_R2_filtered.fastq.gz ref=ref-adapters.fa ktrim=l k=17 ftm=5 qtrim=rl \ + trimq=10 mlf=0.5 maxns=0 swift=t > bbduk.log 2>&1 + +``` + +**Parameter Definitions:** + +* `in` and `in2` – specifies the forward and reverse input reads, respectively (no `in2` if working with single-end data) + +* `out1` and `out2` – specifies the forward and reverse output reads, respectively (no `out2` if working with single-end data) + +* `ref` – specifies a fasta file holding potential adapter sequences (comes with bbduk installation) + +* `ktrim` – specifies to trim adapters from the 5’ end (left) if found + +* `k` – sets minimum length of kmer match to identify adapter sequences (provided by the “ref” file above) + +* `ftm` – sets a multiple of expected length the sequence should be (handles poor additional bases that are sometimes present, see “Force-Trim Modulo” section on [this page](https://jgi.doe.gov/data-and-tools/software-tools/bbtools/bb-tools-user-guide/)) + +* `qtrim` – sets quality-score-based trimming to be applied to left and right sides + +* `trimq` – sets the score to use for PHRED-algorithm trimming + +* `mlf` – sets the minimum length of reads retained based on their initial length + +* `maxns` – sets the maximum number of Ns allowed in a read before it will be filtered out + +* `swift` – tells the program to look for and trim low-complexity adaptase reminants from the Swift1S kit + +* `> bbduk.log 2>&1` – redirects the stderr and stdout to a log file for saving + +**Input data:** + +* *raw.fastq.gz (raw reads) + +**Output data:** + +* **\*_filtered.fastq.gz** (filtered/trimmed reads) +* **\*-bbduk.log** (log file of standard output and error from bbduk run) + +
+ +--- + +### 3. Filtered/Trimmed Data QC +``` +fastqc -o filtered_fastqc_output/ *filtered.fastq.gz +``` + +**Parameter Definitions:** + +* `-o` – the output directory to store results +* `*filtered.fastq.gz` – the input reads are specified as a positional argument, and can be given all at once with wildcards like this, or as individual arguments with spaces in between them + +**Input data:** + +* *filtered.fastq.gz (filtered/trimmed reads) + +**Output data:** + +* *fastqc.html (FastQC output html summary) +* *fastqc.zip (FastQC output data) + + +#### 3a. Compile Filtered/Trimmed Data QC +``` +multiqc -o filtered_multiqc_output -n filtered_multiqc filtered_fastqc_output/ +# this is how it's packaged with our workflow outputs +zip -r filtered_multiqc_GLmetagenomics_report.zip filtered_multiqc_output +``` + +**Parameter Definitions:** + +* `-o` – the output directory to store results +* `-n` – the filename prefix of results +* `filtered_fastqc_output/` – the directory holding the output data from the fastqc run, provided as a positional argument + +**Input data:** + +* filtered_fastqc_output/*fastqc.zip (FastQC output data) + +**Output data:** + +* **filtered_multiqc_GLmetagenomics_report.zip** (zip containing the following) + * **filtered_multiqc.html** (multiqc output html summary) + * **filtered_multiqc_data** (directory containing multiqc output data) + +
+ +--- + +## Assembly-based processing +### 4. Sample assembly +``` +megahit -1 sample-1_R1_filtered.fastq.gz -2 sample-1_R2_filtered.fastq.gz \ + -o sample-1-assembly -t NumberOfThreads --min-contig-length 500 > sample-1-assembly.log 2>&1 +``` + +**Parameter Definitions:** + +* `-1 and -2` – specifies the input forward and reverse reads (if single-end data, then neither `-1` nor `-2` are used, instead single-end reads are passed to `-r`) + +* `-o` – specifies output directory + +* `-t` – specifies the number of threads to use + +* `--min-contig-length` – specifies the minimum contig length to write out + +* `> sample-1-assembly.log 2>&1` – sends stdout/stderr to log file + + +**Input data:** + +* *fastq.gz (filtered/trimmed reads from [step 2](#2-quality-filteringtrimming) above) + +**Output data:** + +* sample-1-assembly/final.contigs.fa (assembly file) +* **sample-1-assembly.log** (log file) + +
+ +--- + +### 5. Renaming contigs and summarizing assemblies + +#### 5a. Renaming contig headers +``` +bit-rename-fasta-headers -i sample-1-assembly/final.contigs.fa -w c_sample-1 -o sample-1-assembly.fasta +``` + +**Parameter Definitions:** + +* `-i` – input fasta file + +* `-w` – wanted header prefix (a number will be appended for each contig), starts with a “c_” to ensure they won’t start with a number which can be problematic + +* `-o` – output fasta file + + +**Input data:** + +* sample-1-assembly/final.contigs.fa (assembly file from [step 4](#4-sample-assembly)) + +**Output files:** + +* **sample-1-assembly.fasta** (contig-renamed assembly file) + + +#### 5b. Summarizing assemblies + +``` +bit-summarize-assembly -o assembly-summaries_GLmetagenomics.tsv *assembly.fasta +``` + +**Parameter Definitions:** + +* `-o` – output summary table + +* – multiple input assemblies can be provided as positional arguments + + +**Input data:** + +* *-assembly.fasta (contig-renamed assembly files from [step 5a](#5a-renaming-contig-headers)) + +**Output files:** + +* **assembly-summaries_GLmetagenomics.tsv** (table of assembly summary statistics) + +
+ +--- + +### 6. Gene prediction +``` +prodigal -a sample-1-genes.faa -d sample-1-genes.fasta -f gff -p meta -c -q \ + -o sample-1-genes.gff -i sample-1-assembly.fasta +``` +**Parameter Definitions:** + +* `-a` – specifies the output amino acid sequences file + +* `-d` – specifies the output nucleotide sequences file + +* `-f` – specifies the output format gene-calls file + +* `-p` – specifies which mode to run the gene-caller in + +* `-c` – no incomplete genes reported + +* `-q` – run in quiet mode (don’t output process on each contig) + +* `-o` – specifies the name of the output gene-calls file + +* `-i` – specifies the input assembly + +**Input data:** + +* sample-1-assembly.fasta (contig-renamed assembly file from [step 5a](#5a-renaming-contig-headers)) + +**Output data:** + +* **sample-1-genes.faa** (gene-calls amino-acid fasta file) +* **sample-1-genes.fasta** (gene-calls nucleotide fasta file) +* **sample-1-genes.gff** (gene-calls in general feature format) + +
+ +--- + +### 7. Functional annotation +> **Notes** +> The annotation process overwrites the same temporary directory by default. So if running multiple processses at a time, it is necessary to specify a specific temporary directory with the `--tmp-dir` argument as shown below. + + +#### 7a. Downloading reference database of HMM models (only needs to be done once) + +``` +curl -LO ftp://ftp.genome.jp/pub/db/kofam/profiles.tar.gz +curl -LO ftp://ftp.genome.jp/pub/db/kofam/ko_list.gz +tar -xzvf profiles.tar.gz +gunzip ko_list.gz +``` + +#### 7b. Running KEGG annotation +``` +exec_annotation -p profiles/ -k ko_list --cpu 15 -f detail-tsv -o sample-1-KO-tab.tmp \ + --tmp-dir sample-1-tmp-KO --report-unannotated sample-1-genes.faa +``` + +**Parameter Definitions:** +* `-p` – specifies the directory holding the downloaded reference HMMs + +* `-k` – specifies the downloaded reference KO (Kegg Orthology) terms + +* `--cpu` – specifies the number of searches to run in parallel + +* `-f` – specifies the output format + +* `-o` – specifies the output file name + +* `--tmp-dir` – specifies the temporary directory to write to (needed if running more than one process concurrently, see Notes above) + +* `--report-unannotated` – specifies to generate an output for each entry + +* `sample-1-genes.faa` – the input file is specified as a positional argument + + +**Input data:** + +* sample-1-genes.faa (amino-acid fasta file, from [step 6](#6-gene-prediction)) +* profiles/ (reference directory holding the KO HMMs) +* ko_list (reference list of KOs to scan for) + +**Output data:** + +* sample-1-KO-tab.tmp (table of KO annotations assigned to gene IDs) + + +#### 7c. Filtering output to retain only those passing the KO-specific score and top hits +``` +bit-filter-KOFamScan-results -i sample-1-KO-tab.tmp -o sample-1-annotations.tsv + + # removing temporary files +rm -rf sample-1-tmp-KO/ sample-1-KO-annots.tmp +``` + +**Parameter Definitions:** + +* `-i` – specifies the input table + +* `-o` – specifies the output table + + +**Input data:** + +* sample-1-KO-tab.tmp (table of KO annotations assigned to gene IDs from [step 7b](#7b-running-kegg-annotation)) + +**Output data:** + +* sample-1-annotations.tsv (table of KO annotations assigned to gene IDs) + +
+ +--- + +### 8. Taxonomic classification + +#### 8a. Pulling and un-packing pre-built reference db (only needs to be done once) +``` +wget tbb.bio.uu.nl/bastiaan/CAT_prepare/CAT_prepare_20200618.tar.gz +tar -xvzf CAT_prepare_20200618.tar.gz +``` + +#### 8b. Running taxonomic classification +``` +CAT contigs -c sample-1-assembly.fasta -d CAT_prepare_20200618/2020-06-18_database/ \ + -t CAT_prepare_20200618/2020-06-18_taxonomy/ -p sample-1-genes.faa \ + -o sample-1-tax-out.tmp -n NumberOfThreads -r 3 --top 4 --I_know_what_Im_doing --no-stars +``` + +**Parameter Definitions:** + +* `-c` – specifies the input assembly fasta file + +* `-d` – specifies the CAT reference sequence database + +* `-t` – specifies the CAT reference taxonomy database + +* `-p` – specifies the input protein fasta file + +* `-o` – specifies the output prefix + +* `-n` – specifies the number of CPU cores to use + +* `-r` – specifies the number of top protein hits to consider in assigning tax + +* `--top` – specifies the number of protein alignments to store + +* `--I_know_what_Im_doing` – allows us to alter the `--top` parameter + +* `--no-stars` - suppress marking of suggestive taxonomic assignments + + +**Input data:** + +* sample-1-assembly.fasta (assembly file from [step 5a](#5a-renaming-contig-headers)) +* sample-1-genes.faa (gene-calls amino-acid fasta file from [step 6](#6-gene-prediction)) + +**Output data:** + +* sample-1-tax-out.tmp.ORF2LCA.txt (gene-calls taxonomy file) +* sample-1-tax-out.tmp.contig2classification.txt (contig taxonomy file) + +#### 8c. Adding taxonomy info from taxids to genes +``` +CAT add_names -i sample-1-tax-out.tmp.ORF2LCA.txt -o sample-1-gene-tax-out.tmp \ + -t CAT_prepare_20200618/2020-06-18_taxonomy/ --only_official --exclude-scores +``` + +**Parameter Definitions:** + +* `-i` – specifies the input taxonomy file + +* `-o` – specifies the output file + +* `-t` – specifies the CAT reference taxonomy database + +* `--only_official` – specifies to add only standard taxonomic ranks + +* `--exclude-scores` - specifies to exclude bit-score support scores in the lineage + +**Input data:** + +* sample-1-tax-out.tmp.ORF2LCA.txt (gene-calls taxonomy file from [step 8b](#8b-running-taxonomic-classification)) + +**Output data:** + +* sample-1-gene-tax-out.tmp (gene-calls taxonomy file with lineage info added) + + + +#### 8d. Adding taxonomy info from taxids to contigs +``` +CAT add_names -i sample-1-tax-out.tmp.contig2classification.txt -o sample-1-contig-tax-out.tmp \ + -t CAT-ref/2020-06-18_taxonomy/ --only_official --exclude-scores +``` + +**Parameter Definitions:** + +* `-i` – specifies the input taxonomy file + +* `-o` – specifies the output file + +* `-t` – specifies the CAT reference taxonomy database + +* `--only_official` – specifies to add only standard taxonomic ranks + +* `--exclude-scores` - specifies to exclude bit-score support scores in the lineage + + +**Input data:** + +* sample-1-tax-out.tmp.contig2classification.txt (contig taxonomy file from [step 8b](#8b-running-taxonomic-classification)) + +**Output data:** + +* sample-1-contig-tax-out.tmp (contig taxonomy file with lineage info added) + + +#### 8e. Formatting gene-level output with awk and sed +``` +awk -F $'\t' ' BEGIN { OFS=FS } { if ( $3 == "lineage" ) { print $1,$3,$5,$6,$7,$8,$9,$10,$11 } \ + else if ( $2 == "ORF has no hit to database" || $2 ~ /^no taxid found/ ) \ + { print $1,"NA","NA","NA","NA","NA","NA","NA","NA" } else { n=split($3,lineage,";"); \ + print $1,lineage[n],$5,$6,$7,$8,$9,$10,$11 } } ' sample-1-gene-tax-out.tmp | \ + sed 's/no support/NA/g' | sed 's/superkingdom/domain/' | sed 's/# ORF/gene_ID/' | \ + sed 's/lineage/taxid/' > sample-1-gene-tax-out.tsv +``` + +#### 8f. Formatting contig-level output with awk and sed +``` +awk -F $'\t' ' BEGIN { OFS=FS } { if ( $2 == "classification" ) { print $1,$4,$6,$7,$8,$9,$10,$11,$12 } \ + else if ( $2 == "no taxid assigned" ) { print $1,"NA","NA","NA","NA","NA","NA","NA","NA" } \ + else { n=split($4,lineage,";"); print $1,lineage[n],$6,$7,$8,$9,$10,$11,$12 } } ' sample-1-contig-tax-out.tmp | \ + sed 's/no support/NA/g' | sed 's/superkingdom/domain/' | sed 's/^# contig/contig_ID/' | \ + sed 's/lineage/taxid/' > sample-1-contig-tax-out.tsv + + # clearing intermediate files +rm sample-1*.tmp* +``` + +**Input data:** + +* sample-1-gene-tax-out.tmp (gene-calls taxonomy file with lineage info added from [step 8c](#8c-adding-taxonomy-info-from-taxids-to-genes)) +* sample-1-contig-tax-out.tmp (contig taxonomy file with lineage info added from [step 8d](#8d-adding-taxonomy-info-from-taxids-to-contigs)) + + +**Output data:** + +* sample-1-gene-tax-out.tsv (gene-calls taxonomy file with lineage info added reformatted) +* sample-1-contig-tax-out.tsv (contig taxonomy file with lineage info added reformatted) + +
+ +--- + +### 9. Read-mapping + +#### 9a. Building reference index +``` +bowtie2-build sample-1-assembly.fasta sample-1-assembly-bt-index +``` + +**Parameter Definitions:** + +* `sample-1-assembly.fasta` - first positional argument specifies the input assembly + +* `sample-1-assembly-bt-index` - second positional argument specifies the prefix of the output index files + + +#### 9b. Performing mapping, conversion to bam, and sorting +``` +bowtie2 --threads NumberOfThreads -x sample-1-assembly-bt-index -1 sample-1_R1_filtered.fastq.gz \ + -2 sample-1_R2_filtered.fastq.gz --no-unal 2> sample-1-mapping-info.txt | samtools view -b | samtools sort -@ NumberOfThreads > sample-1.bam +``` + +**Parameter Definitions:** + +* `--threads` – specifies the number of threads to run in parallel + +* `-x` – specifies the prefix of the reference index files to map to (generated in [step 9a](#9a-building-reference-index)) + +* `-1 and -2` – specifies the forward and reverse reads to map (if single-end data, neither `-1` nor `-2` are provided, and the single-end reads are passed to `-r`) + +* `--no-unal` - suppress SAM records for unaligned reads + +* `2> sample-1-mapping-info.txt` – capture the printed summary results in a log file + +* `samtools view -b` – convert the output directly to bam format (compressed) + +* `samtools sort -@` – sort the bam file using the specified number of threads + +* `>` – redirect the output to a file + +#### 9c. Indexing +``` +samtools index -@ NumberOfThreads sample-1.bam +``` + +**Parameter Definitions:** +* `-@` – set number of threads to use + +* `sample-1.bam` - input bam file is provided as a positional argument as generated in [step 9b](#9b-performing-mapping-conversion-to-bam-and-sorting) + +**Input data:** + +* sample-1-assembly.fasta (assembly file from [step 5](#5a-renaming-contig-headers)) +* *.fastq.gz (filtered/trimmed reads from [step 2](#2-quality-filteringtrimming)) + +**Output data:** + +* **sample-1.bam** (mapping file) +* sample-1.bam.bai (bam index file) +* **sample-1-mapping-info.txt** (read-mapping log file) + +
+ +--- + +### 10. Getting coverage information and filtering based on detection +> **Notes** +> “Detection” is a metric of what proportion of a reference sequence recruited reads (see [here](http://merenlab.org/2017/05/08/anvio-views/#detection)). Filtering based on detection is one way of helping to mitigate non-specific read-recruitment. + +#### 10a. Filtering coverage levels based on detection + +``` + # pileup.sh comes from the bbduk.sh package +pileup.sh -in sample-1.bam fastaorf=sample-1-genes.fasta outorf=sample-1-gene-cov-and-det.tmp \ + out=sample-1-contig-cov-and-det.tmp +``` + +**Parameter Definitions:** + +* `-in` – the input bam file + +* `fastaorf=` – input gene-calls nucleotide fasta file + +* `outorf=` – the output gene-coverage tsv file + +* `out=` – the output contig-coverage tsv file + + +#### 10b. Filtering gene coverage based on requiring 50% detection and parsing down to just gene ID and coverage +``` +grep -v "#" sample-1-gene-cov-and-det.tmp | awk -F $'\t' ' BEGIN { OFS=FS } { if ( $10 <= 0.5 ) $4 = 0 } \ + { print $1,$4 } ' > sample-1-gene-cov.tmp + +cat <( printf "gene_ID\tcoverage\n" ) sample-1-gene-cov.tmp > sample-1-gene-coverages.tsv +``` + +Filtering contig coverage based on requiring 50% detection and parsing down to just contig ID and coverage: +``` +grep -v "#" sample-1-contig-cov-and-det.tmp | awk -F $'\t' ' BEGIN { OFS=FS } { if ( $5 <= 50 ) $2 = 0 } \ + { print $1,$2 } ' > sample-1-contig-cov.tmp + +cat <( printf "contig_ID\tcoverage\n" ) sample-1-contig-cov.tmp > sample-1-contig-coverages.tsv + + # removing intermediate files + +rm sample-1-*.tmp +``` + +**Input data:** + +* sample-1.bam (mapping file from [step 9b](#9b-performing-mapping-conversion-to-bam-and-sorting)) +* sample-1-genes.fasta (gene-calls nucleotide fasta file from [step 6](#6-gene-prediction)) + +**Output data:** + +* sample-1-gene-coverages.tsv (table with gene-level coverages) +* sample-1-contig-coverages.tsv (table with contig-level coverages) + +
+ +--- + +### 11. Combining gene-level coverage, taxonomy, and functional annotations into one table for each sample +> **Notes** +> Just uses `paste`, `sed`, and `awk`, all are standard in any Unix-like environment. + +``` +paste <( tail -n +2 sample-1-gene-coverages.tsv | sort -V -k 1 ) <( tail -n +2 sample-1-annotations.tsv | sort -V -k 1 | cut -f 2- ) \ + <( tail -n +2 sample-1-gene-tax-out.tsv | sort -V -k 1 | cut -f 2- ) > sample-1-gene-tab.tmp + +paste <( head -n 1 sample-1-gene-coverages.tsv ) <( head -n 1 sample-1-annotations.tsv | cut -f 2- ) \ + <( head -n 1 sample-1-gene-tax-out.tsv | cut -f 2- ) > sample-1-header.tmp + +cat sample-1-header.tmp sample-1-gene-tab.tmp > sample-1-gene-coverage-annotation-and-tax.tsv + + # removing intermediate files +rm sample-1*tmp sample-1-gene-coverages.tsv sample-1-annotations.tsv sample-1-gene-tax-out.tsv +``` + +**Input data:** + +* sample-1-gene-coverages.tsv (table with gene-level coverages from [step 10b](#10b-filtering-gene-coverage-based-on-requiring-50-detection-and-parsing-down-to-just-gene-id-and-coverage)) +* sample-1-annotations.tsv (table of KO annotations assigned to gene IDs from [step 7c](#7c-filtering-output-to-retain-only-those-passing-the-ko-specific-score-and-top-hits)) +* sample-1-gene-tax-out.tsv (gene-level taxonomic classifications from [step 8f](#8f-formatting-contig-level-output-with-awk-and-sed)) + + +**Output data:** + +* **sample-1-gene-coverage-annotation-and-tax.tsv** (table with combined gene coverage, annotation, and taxonomy info) + +
+ +--- + +### 12. Combining contig-level coverage and taxonomy into one table for each sample +> **Notes** +> Just uses `paste`, `sed`, and `awk`, all are standard in any Unix-like environment. + +``` +paste <( tail -n +2 sample-1-contig-coverages.tsv | sort -V -k 1 ) \ + <( tail -n +2 sample-1-contig-tax-out.tsv | sort -V -k 1 | cut -f 2- ) > sample-1-contig.tmp + +paste <( head -n 1 sample-1-contig-coverages.tsv ) <( head -n 1 sample-1-contig-tax-out.tsv | cut -f 2- ) \ + > sample-1-contig-header.tmp + +cat sample-1-contig-header.tmp sample-1-contig.tmp > sample-1-contig-coverage-and-tax.tsv + + # removing intermediate files +rm sample-1*tmp sample-1-contig-coverages.tsv sample-1-contig-tax-out.tsv +``` + +**Input data:** + +* sample-1-contig-coverages.tsv (table with contig-level coverages from [step 10b](#10b-filtering-gene-coverage-based-on-requiring-50-detection-and-parsing-down-to-just-gene-id-and-coverage)) +* sample-1-contig-tax-out.tsv (contig-level taxonomic classifications from [step 8f](#8f-formatting-contig-level-output-with-awk-and-sed)) + + +**Output data:** + +* **sample-1-contig-coverage-and-tax.tsv** (table with combined contig coverage and taxonomy info) + +
+ +--- + +### 13. Generating normalized, gene- and contig-level coverage summary tables of KO-annotations and taxonomy across samples + +> **Notes** +> * To combine across samples to generate these summary tables, we need the same "units". This is done for annotations based on the assigned KO terms, and all non-annotated functions are included together as "Not annotated". It is done for taxonomic classifications based on taxids (full lineages included in the table), and any not classified are included together as "Not classified". +> * The values we are working with are coverage per gene (so they are number of bases recruited to the gene normalized by the length of the gene). These have been normalized by making the total coverage of a sample 1,000,000 and setting each individual gene-level coverage its proportion of that 1,000,000 total. So basically percent, but out of 1,000,000 instead of 100 to make the numbers more friendly. + +#### 13a. Generating gene-level coverage summary tables + +``` +bit-GL-combine-KO-and-tax-tables *-gene-coverage-annotation-and-tax.tsv -o Combined +``` + +**Parameter Definitions:** + +* takes positional arguments specifying the input tsv files, can be provided as a space-delimited list of files, or with wildcards like above + +- `-o` – specifies the output prefix + + +**Input data:** + +* *-gene-coverage-annotation-and-tax.tsv (tables with combined gene coverage, annotation, and taxonomy info generated for individual samples from [step 11](#11-combining-gene-level-coverage-taxonomy-and-functional-annotations-into-one-table-for-each-sample)) + +**Output data:** + +* **Combined-gene-level-KO-function-coverages-CPM_GLmetagenomics.tsv** (table with all samples combined based on KO annotations; normalized to coverage per million genes covered) +* **Combined-gene-level-taxonomy-coverages-CPM_GLmetagenomics.tsv** (table with all samples combined based on gene-level taxonomic classifications; normalized to coverage per million genes covered) +* **Combined-gene-level-KO-function-coverages_GLmetagenomics.tsv** (table with all samples combined based on KO annotations) +* **Combined-gene-level-taxonomy-coverages_GLmetagenomics.tsv** (table with all samples combined based on gene-level taxonomic classifications) + + +#### 13b. Generating contig-level coverage summary tables + +``` +bit-GL-combine-contig-tax-tables *-contig-coverage-and-tax.tsv -o Combined +``` +**Parameter Definitions:** + +* takes positional arguments specifying the input tsv files, can be provided as a space-delimited list of files, or with wildcards like above + +- `-o` – specifies the output prefix + + +**Input data:** + +* *-contig-coverage-annotation-and-tax.tsv (tables with combined contig coverage, annotation, and taxonomy info generated for individual samples from [step 12](#12-combining-contig-level-coverage-and-taxonomy-into-one-table-for-each-sample)) + +**Output data:** + +* **Combined-contig-level-taxonomy-coverages-CPM_GLmetagenomics.tsv** (table with all samples combined based on contig-level taxonomic classifications; normalized to coverage per million genes covered) +* **Combined-contig-level-taxonomy-coverages_GLmetagenomics.tsv** (table with all samples combined based on contig-level taxonomic classifications) + +
+ +--- + +### 14. **M**etagenome-**A**ssembled **G**enome (MAG) recovery + +#### 14a. Binning contigs +``` +jgi_summarize_bam_contig_depths --outputDepth sample-1-metabat-assembly-depth.tsv --percentIdentity 97 --minContigLength 1000 --minContigDepth 1.0 --referenceFasta sample-1-assembly.fasta sample-1.bam + +metabat2 --inFile sample-1-assembly.fasta --outFile sample-1 --abdFile sample-1-metabat-assembly-depth.tsv -t NumberOfThreads + +mkdir sample-1-bins +mv sample-1*bin*.fasta sample-1-bins +zip -r sample-1-bins.zip sample-1-bins +``` + +**Parameter Definitions:** + +* `--outputDepth` – specifies the output depth file +* `--percentIdentity` – minimum end-to-end percent identity of a mapped read to be included +* `--minContigLength` – minimum contig length to include +* `--minContigDepth` – minimum contig depth to include +* `--referenceFasta` – the assembly fasta file generated in step 5a +* `sample-1.bam` – final positional arguments are the bam files generated in step 9 +* `--inFile` - the assembly fasta file generated in step 5a +* `--outFile` - the prefix of the identified bins output files +* `--abdFile` - the depth file generated by the previous `jgi_summarize_bam_contig_depths` command +* `-t` - specifies number of threads to use + + +**Input data:** + +* sample-1-assembly.fasta (assembly fasta file created in [step 5a](#5a-renaming-contig-headers)) +* sample-1.bam (bam file created in [step 9b](#9b-performing-mapping-conversion-to-bam-and-sorting)) + +**Output data:** + +* **sample-1-metabat-assembly-depth.tsv** (tab-delimited summary of coverages) +* sample-1-bins/sample-1-bin\*.fasta (fasta files of recovered bins) +* **sample-1-bins.zip** (zip file containing fasta files of recovered bins) + +#### 14b. Bin quality assessment +Utilizes the default `checkm` database available [here](https://data.ace.uq.edu.au/public/CheckM_databases/checkm_data_2015_01_16.tar.gz), `checkm_data_2015_01_16.tar.gz`. + +``` +checkm lineage_wf -f bins-overview_GLmetagenomics.tsv --tab_table -x fa ./ checkm-output-dir +``` + +**Parameter Definitions:** + +* `lineage_wf` – specifies the workflow being utilized +* `-f` – specifies the output summary file +* `--tab_table` – specifies the output summary file should be a tab-delimited table +* `-x` – specifies the extension that is on the bin fasta files that are being assessed +* `./` – first positional argument at end specifies the directory holding the bins generated in step 14a +* `checkm-output-dir` – second positional argument at end specifies the primary checkm output directory with detailed information + +**Input data:** + +* sample-1-bins/sample-1-bin\*.fasta (bin fasta files generated in [step 14a](#14a-binning-contigs)) + +**Output data:** + +* **bins-overview_GLmetagenomics.tsv** (tab-delimited file with quality estimates per bin) +* checkm-output-dir (directory holding detailed checkm outputs) + +#### 14c. Filtering MAGs + +``` +cat <( head -n 1 bins-overview_GLmetagenomics.tsv ) \ + <( awk -F $'\t' ' $12 >= 90 && $13 <= 10 && $14 == 0 ' bins-overview_GLmetagenomics.tsv | sed 's/bin./MAG-/' ) \ + > checkm-MAGs-overview.tsv + +# copying bins into a MAGs directory in order to run tax classification +awk -F $'\t' ' $12 >= 90 && $13 <= 10 && $14 == 0 ' bins-overview_GLmetagenomics.tsv | cut -f 1 > MAG-bin-IDs.tmp + +mkdir MAGs +for ID in MAG-bin-IDs.tmp +do + MAG_ID=$(echo $ID | sed 's/bin./MAG-/') + cp ${ID}.fasta MAGs/${MAG_ID}.fasta +done + +for SAMPLE in $(cat MAG-bin-IDs.tmp | sed 's/-bin.*//' | sort -u); +do + mkdir ${SAMPLE}-MAGs + mv ${SAMPLE}-*MAG*.fasta ${SAMPLE}-MAGs + zip -r ${SAMPLE}-MAGs.zip ${SAMPLE}-MAGs +done +``` + +**Input data:** + +* bins-overview_GLmetagenomics.tsv (tab-delimited file with quality estimates per bin from [step 14b](#14b-bin-quality-assessment)) + +**Output data:** + +* checkm-MAGs-overview.tsv (tab-delimited file with quality estimates per MAG) +* MAGs/\*.fasta (directory holding high-quality MAGs) +* **\*-MAGs.zip** (zip files containing directories of high-quality MAGs) + + +#### 14d. MAG taxonomic classification +Uses default `gtdbtk` database setup with program's `download.sh` command. + +``` +gtdbtk classify_wf --genome_dir MAGs/ -x fa --out_dir gtdbtk-output-dir --skip_ani_screen +``` + +**Parameter Definitions:** + +* `classify_wf` – specifies the workflow being utilized +* `--genome_dir` – specifies the directory holding the MAGs generated in step 14c +* `-x` – specifies the extension that is on the MAG fasta files that are being taxonomically classified +* `--out_dir` – specifies the output directory +* `--skip_ani_screen` - specifies to skip ani_screening step to classify genomes using mash and skani + +**Input data:** + +* MAGs/\*.fasta (directory holding high-quality MAGs from [step 14c](#14c-filtering-mags)) + +**Output data:** + +* gtdbtk-output-dir/gtdbtk.\*.summary.tsv (files with assigned taxonomy and info) + +#### 14e. Generating overview table of all MAGs + +```bash +# combine summaries +for MAG in $(cut -f 1 assembly-summaries_GLmetagenomics.tsv | tail -n +2); do + + grep -w -m 1 "^${MAG}" checkm-MAGs-overview.tsv | cut -f 12,13,14 \ + >> checkm-estimates.tmp + + grep -w "^${MAG}" gtdbtk-output-dir/gtdbtk.*.summary.tsv | \ + cut -f 2 | sed 's/^.__//' | \ + sed 's/;.__/\t/g' | \ + awk 'BEGIN{ OFS=FS="\t" } { for (i=1; i<=NF; i++) if ( $i ~ /^ *$/ ) $i = "NA" }; 1' \ + >> gtdb-taxonomies.tmp + +done + +# Add headers +cat <(printf "est. completeness\test. redundancy\test. strain heterogeneity\n") checkm-estimates.tmp \ + > checkm-estimates-with-headers.tmp + +cat <(printf "domain\tphylum\tclass\torder\tfamily\\tgenus\tspecies\n") gtdb-taxonomies.tmp \ + > gtdb-taxonomies-with-headers.tmp + +paste assembly-summaries_GLmetagenomics.tsv \ +checkm-estimates-with-headers.tmp \ +gtdb-taxonomies-with-headers.tmp \ + > MAGs-overview.tmp + +# Ordering by taxonomy +head -n 1 MAGs-overview.tmp > MAGs-overview-header.tmp + +tail -n +2 MAGs-overview.tmp | sort -t \$'\t' -k 14,20 > MAGs-overview-sorted.tmp + +cat MAGs-overview-header.tmp MAGs-overview-sorted.tmp \ + > MAGs-overview_GLmetagenomics.tsv + +``` + +**Input data:** + +* assembly-summaries_GLmetagenomics.tsv (table of assembly summary statistics from [step 5b](#5b-summarizing-assemblies)) +* MAGs/\*.fasta (directory holding high-quality MAGs from [step 14c](#14c-filtering-mags)) +* checkm-MAGs-overview.tsv (tab-delimited file with quality estimates per MAG from [step 14c](#14c-filtering-mags)) +* gtdbtk-output-dir/gtdbtk.\*.summary.tsv (directory of files with assigned taxonomy and info from [step 14d](#14d-mag-taxonomic-classification)) + +**Output data:** + +* **MAGs-overview_GLmetagenomics.tsv** (a tab-delimited overview of all recovered MAGs) + + +
+ +--- + +### 15. Generating MAG-level functional summary overview + +#### 15a. Getting KO annotations per MAG +This utilizes the helper script [`parse-MAG-annots.py`](../Workflow_Documentation/NF_MGIllumina/workflow_code/bin/parse-MAG-annots.py) + +```bash +for file in $( ls MAGs/*.fasta ) +do + + MAG_ID=$( echo ${file} | cut -f 2 -d "/" | sed 's/.fasta//' ) + sample_ID=$( echo ${MAG_ID} | sed 's/-MAG-[0-9]*$//' ) + + grep "^>" ${file} | tr -d ">" > ${MAG_ID}-contigs.tmp + + python parse-MAG-annots.py -i annotations-and-taxonomy/${sample_ID}-gene-coverage-annotation-and-tax.tsv \ + -w ${MAG_ID}-contigs.tmp -M ${MAG_ID} \ + -o MAG-level-KO-annotations_GLmetagenomics.tsv + + rm ${MAG_ID}-contigs.tmp + +done +``` + +**Parameter Definitions:** + +* `-i` – specifies the input sample gene-coverage-annotation-and-tax.tsv file generated in step 11 + +* `-w` – specifies the appropriate temporary file holding all the contigs in the current MAG + +* `-M` – specifies the current MAG unique identifier + +* `-o` – specifies the output file + +**Input data:** + +* \*-gene-coverage-annotation-and-tax.tsv (sample gene-coverage-annotation-and-tax.tsv file generated in [step 11](#11-combining-gene-level-coverage-taxonomy-and-functional-annotations-into-one-table-for-each-sample)) +* MAGs/\*.fasta (directory holding high-quality MAGs from [step 14c](#14c-filtering-mags)) + +**Output data:** + +* **MAG-level-KO-annotations_GLmetagenomics.tsv** (tab-delimited table holding MAGs and their KO annotations) + + +#### 15b. Summarizing KO annotations with KEGG-Decoder + +```bash +KEGG-decoder -v interactive -i MAG-level-KO-annotations_GLmetagenomics.tsv -o MAG-KEGG-Decoder-out_GLmetagenomics.tsv +``` + +**Parameter Definitions:** + +* `-v interactive` – specifies to create an interactive html output + +* `-i` – specifies the input MAG-level-KO-annotations_GLmetagenomics.tsv file generated in [step 15a](#15a-getting-ko-annotations-per-mag) + +* `-o` – specifies the output table + +**Input data:** + +* MAG-level-KO-annotations_GLmetagenomics.tsv (tab-delimited table holding MAGs and their KO annotations, generated in [step 15a](#15a-getting-ko-annotations-per-mag)) + +**Output data:** + +* **MAG-KEGG-Decoder-out_GLmetagenomics.tsv** (tab-delimited table holding MAGs and their proportions of genes held known to be required for specific pathways/metabolisms) + +* **MAG-KEGG-Decoder-out_GLmetagenomics.html** (interactive heatmap html file of the above output table) + +
+--- + +## Read-based processing +### 16. Taxonomic and functional profiling +The following uses the `humann` and `metaphlan` reference databases downloaded on 13-Jun-2024 as follows: + +```bash +humann_databases --download chocophlan full +humann_databases --download uniref uniref90_diamond +humann_databases --download utility_mapping full +metaphlan --install +``` + +#### 16a. Running humann (which also runs metaphlan) +```bash + # forward and reverse reads need to be provided combined if paired-end (if not paired-end, single-end reads are provided to the --input argument next) +cat sample-1_R1_filtered.fastq.gz sample-1_R2_filtered.fastq.gz > sample-1-combined.fastq.gz + +humann --input sample-1-combined.fastq.gz --output sample-1-humann3-out-dir --threads NumberOfThreads \ + --output-basename sample-1 --metaphlan-options "--unknown_estimation --add_viruses \ + --sample_id sample-1" +``` + +**Parameter Definitions:** + +* `--input` – specifies the input combined forward and reverse reads (if paired-end) + +* `--output` – specifies output directory + +* `--threads` – specifies the number of threads to use + +* `--output-basename` – specifies prefix of the output files + +* `--metaphlan-options` – options to be passed to metaphlan + * `--unknown_estimation` – include unclassified in estimated relative abundances + * `--add_viruses` – include viruses in the reference database + * `--sample_id` – specifies the sample identifier we want in the table (rather than full filename) + + +#### 16b. Merging multiple sample functional profiles into one table +```bash + # they need to be in their own directories +mkdir genefamily-results/ pathabundance-results/ pathcoverage-results/ + + # copying results from previous running humann3 step (16a) to get them all together in their own directories (as is needed) +cp *-humann3-out-dir/*genefamilies.tsv genefamily-results/ +cp *-humann3-out-dir/*abundance.tsv pathabundance-results/ +cp *-humann3-out-dir/*coverage.tsv pathcoverage-results/ + +humann_join_tables -i genefamily-results/ -o gene-families.tsv +humann_join_tables -i pathabundance-results/ -o path-abundances.tsv +humann_join_tables -i pathcoverage-results/ -o path-coverages.tsv +``` + +**Parameter Definitions:** + +* `-i` – the directory holding the input tables + +* `-o` – the name of the output combined table + + +#### 16c. Splitting results tables +The read-based functional annotation tables have taxonomic info and non-taxonomic info mixed together initially. `humann` comes with a helper script to split these. Here we are using that to generate both non-taxonomically grouped functional info files and taxonomically grouped ones. + +```bash +humann_split_stratified_table -i gene-families.tsv -o ./ +mv gene-families_stratified.tsv Gene-families-grouped-by-taxa_GLmetagenomics.tsv +mv gene-families_unstratified.tsv Gene-families_GLmetagenomics.tsv + +humann_split_stratified_table -i path-abundances.tsv -o ./ +mv path-abundances_stratified.tsv Path-abundances-grouped-by-taxa_GLmetagenomics.tsv +mv path-abundances_unstratified.tsv Path-abundances_GLmetagenomics.tsv + +humann2_split_stratified_table -i path-coverages.tsv -o ./ +mv path-coverages_stratified.tsv Path-coverages-grouped-by-taxa_GLmetagenomics.tsv +mv path-coverages_unstratified.tsv Path-coverages_GLmetagenomics.tsv +``` + +**Parameter Definitions:** + +* `-i` – the input combined table + +* `-o` – output directory (here specifying current directory) + + +#### 16d. Normalizing gene families and pathway abundance tables +This generates some normalized tables of the read-based functional outputs from humann that are more readily suitable for across sample comparisons. + +```bash +humann_renorm_table -i Gene-families_GLmetagenomics.tsv -o Gene-families-cpm_GLmetagenomics.tsv --update-snames +humann_renorm_table -i Path-abundances_GLmetagenomics.tsv -o Path-abundances-cpm_GLmetagenomics.tsv --update-snames +``` + +**Parameter Definitions:** + +* `-i` – the input combined table + +* `-o` – name of the output normalized table + +* `--update-snames` – change suffix of column names in tables to "-CPM" + + +#### 16e. Generating a normalized gene-family table that is grouped by Kegg Orthologs (KOs) + +```bash +humann_regroup_table -i Gene-families_GLmetagenomics.tsv -g uniref90_ko | humann_rename_table -n kegg-orthology | \ + humann_renorm_table -o Gene-families-KO-cpm_GLmetagenomics.tsv --update-snames +``` + +**Parameter Definitions:** + +* `-i` – the input table + +* `-g` – the map to use to group uniref IDs into Kegg Orthologs + +* `|` – sending that output into the next humann command to add human-readable Kegg Orthology names + +* `-n` – specifying we are converting Kegg orthology IDs into Kegg orthology human-readable names + +* `|` – sending that output into the next humann command to normalize to copies-per-million + +* `-o` – specifying the final output file name + +* `--update-snames` – change suffix of column names in tables to "-CPM" + +#### 16f. Combining taxonomy tables + +```bash +merge_metaphlan_tables.py *-humann3-out-dir/*_humann_temp/*_metaphlan_bugs_list.tsv > Metaphlan-taxonomy_GLmetagenomics.tsv +``` + +**Parameter Definitions:** + +* input metaphlan tables are provided as position arguments (produced during humann3 run in [step 16a](#16a-running-humann-which-also-runs-metaphlan) + +* `>` – output is redirected from stdout to a file + + +**Input data:** + +* *fastq.gz (filtered/trimmed reads from [step 2](#2-quality-filteringtrimming), forward and reverse reads concatenated if paired-end) + +**Output data:** + +* **Gene-families_GLmetagenomics.tsv** (gene-family abundances) +* **Gene-families-grouped-by-taxa_GLmetagenomics.tsv** (gene-family abundances grouped by taxa) +* **Gene-families-cpm_GLmetagenomics.tsv** (gene-family abundances normalized to copies-per-million) +* **Gene-families-KO-cpm_GLmetagenomics.tsv** (KO term abundances normalized to copies-per-million) +* **Pathway-abundances_GLmetagenomics.tsv** (pathway abundances) +* **Pathway-abundances-grouped-by-taxa_GLmetagenomics.tsv** (pathway abundances grouped by taxa) +* **Pathway-abundances-cpm_GLmetagenomics.tsv** (pathway abundances normalized to copies-per-million) +* **Pathway-coverages_GLmetagenomics.tsv** (pathway coverages) +* **Pathway-coverages-grouped-by-taxa_GLmetagenomics.tsv** (pathway coverages grouped by taxa) +* **Metaphlan-taxonomy_GLmetagenomics.tsv** (metaphlan estimated taxonomic relative abundances) + +--- diff --git a/Metagenomics/Illumina/README.md b/Metagenomics/Illumina/README.md index 881134f70..0b842d288 100644 --- a/Metagenomics/Illumina/README.md +++ b/Metagenomics/Illumina/README.md @@ -1,7 +1,7 @@ # GeneLab bioinformatics processing pipeline for Illumina metagenomics sequencing data -> **The document [`GL-DPPD-7107.md`](Pipeline_GL-DPPD-7107_Versions/GL-DPPD-7107.md) holds an overview and example commands for how GeneLab processes Illumina metagenomics sequencing datasets. See the [Repository Links](#repository-links) descriptions below for more information. Processed data output files and processing code are provided for each GLDS dataset in the [Open Science Data Repository (OSDR)](https://osdr.nasa.gov/bio/repo/).** +> **The document [`GL-DPPD-7107-A.md`](Pipeline_GL-DPPD-7107_Versions/GL-DPPD-7107-A.md) holds an overview and example commands for how GeneLab processes Illumina metagenomics sequencing datasets. See the [Repository Links](#repository-links) descriptions below for more information. Processed data output files and processing code are provided for each GLDS dataset in the [Open Science Data Repository (OSDR)](https://osdr.nasa.gov/bio/repo/).** > > Note: The exact processing commands and MGIllumina version used for specific GLDS datasets can be found in the *_processing_info.zip file under "Files" for each respective GLDS dataset in the [Open Science Data Repository (OSDR)](https://osdr.nasa.gov/bio/repo/). @@ -26,4 +26,4 @@ --- **Developed and maintained by:** -Michael D. Lee (Mike.Lee@nasa.gov) +Michael D. Lee (Mike.Lee@nasa.gov) and Olabiyi A.Obayomi (olabiyi.a.obayomi@nasa.gov) diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/CHANGELOG.md b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/CHANGELOG.md new file mode 100644 index 000000000..37e390396 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/CHANGELOG.md @@ -0,0 +1,28 @@ +# Workflow change log + +All notable changes to this project will be documented in this file. + +The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/), +and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html). + + +## [1.0.0](https://github.com/nasa/GeneLab_Data_Processing/tree/NF_MGIllumina_1.0.0/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina) + +### Changed +- Update to the latest pipeline version [GL-DPPD-7101-A](../../Pipeline_GL-DPPD-7107_Versions/GL-DPPD-7107-A.md) +of the GeneLab Metagenomics consensus processing pipeline. +- Pipeline implementation as a Nextflow workflow [NF_MGIllumina](./) rather than Snakemake as in +previous workflow versions. +- Run checkm separately on each bin and combine results to improve performance + +### Fixed +- Allow explicit specification of the humann3 database location ([#62](https://github.com/nasa/GeneLab_Data_Processing/issues/62)) +- Package bin and MAGs fasta files into per sample zip archives ([#76](https://github.com/nasa/GeneLab_Data_Processing/issues/76)) + +
+ +--- + +> ***Note:** All previous workflow changes were associated with the previous version of the GeneLab Metagenomics Pipeline +[GL-DPPD-7101](../../Pipeline_GL-DPPD-7107_Versions/GL-DPPD-7107.md) and can be found in the +[change log of the Snakemake workflow (SW_MGIllumina)](../SW_MGIllumina/CHANGELOG.md).* \ No newline at end of file diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/README.md b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/README.md new file mode 100644 index 000000000..c82b13bec --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/README.md @@ -0,0 +1,228 @@ +# Workflow Information and Usage Instructions + +## General Workflow Info + +### Implementation Tools + +The current GeneLab Illumina metagenomics sequencing data processing pipeline (MGIllumina-A), [GL-DPPD-7107-A.md](../../Pipeline_GL-DPPD-7107_Versions/GL-DPPD-7107-A.md), is implemented as a [Nextflow](https://nextflow.io/) DSL2 workflow and utilizes [Singularity](https://docs.sylabs.io/guides/3.10/user-guide/introduction.html) containers, [Docker](https://docs.docker.com/get-started/) containers, or [conda](https://docs.conda.io/en/latest/) environments to install/run all tools. This workflow is run using the command line interface (CLI) of any unix-based system. While knowledge of creating workflows in Nextflow is not required to run the workflow as is, [the Nextflow documentation](https://nextflow.io/docs/latest/index.html) is a useful resource for users who want to modify and/or extend this workflow. + +> **Note on reference databases** +> Many reference databases are relied upon throughout this workflow. They will be installed and setup automatically the first time the workflow is run. All together, after installed and unpacked, they will take up about about 340 GB of storage, but they may also require up to 500GB during installation and initial un-packing, so be sure there is enough room on your system before running the workflow. + +
+ +## Utilizing the Workflow + +1. [Installing Nextflow, Singularity, and conda](#1-installing-nextflow-singularity-and-conda) + 1a. [Install Nextflow and conda](#1a-install-nextflow-and-conda) + 1b. [Install Singularity](#1b-install-singularity) +2. [Download the workflow files](#2-download-the-workflow-files) +3. [Fetch Singularity Images](#3-fetch-singularity-images) +4. [Run the workflow](#4-run-the-workflow) + 4a. [Approach 1: Start with OSD or GLDS accession as input](#4a-approach-1-start-with-an-osd-or-glds-accession-as-input) + 4b. [Approach 2: Start with a runsheet csv file as input](#4b-approach-2-start-with-a-runsheet-csv-file-as-input) + 4c. [Modify parameters and compute resources in the Nextflow config file](#4c-modify-parameters-and-compute-resources-in-the-nextflow-config-file) +5. [Workflow outputs](#5-workflow-outputs) + 5a. [Main outputs](#5a-main-outputs) + 5b. [Resource logs](#5b-resource-logs) +6. [Post Processing](#6-post-processing) + +
+ +--- + +### 1. Installing Nextflow, Singularity, and conda + +#### 1a. Install Nextflow and conda + +Nextflow can be installed either through [Anaconda](https://anaconda.org/bioconda/nextflow) or as documented on the [Nextflow documentation page](https://www.nextflow.io/docs/latest/getstarted.html). + +> Note: If you want to install Anaconda, we recommend installing a Miniconda version appropriate for your system, as instructed by [Happy Belly Bioinformatics](https://astrobiomike.github.io/unix/conda-intro#getting-and-installing-conda). +> +> Once conda is installed on your system, you can install the latest version of Nextflow by running the following commands: +> +> ```bash +> conda install -c bioconda nextflow +> nextflow self-update +> ``` +> You may also install [mamba](https://mamba.readthedocs.io/en/latest/index.html) first which is a faster implementation of conda and can be used as a drop-in replacement: +> ```bash +> conda install -c conda-forge mamba +> conda install -c bioconda nextflow +> nextflow self-update +> ``` + +
+ +#### 1b. Install Singularity + +Singularity is a container platform that allows usage of containerized software. This enables the GeneLab workflow to retrieve and use all software required for processing without the need to install the software directly on the user's system. + +We recommend installing Singularity on a system wide level as per the associated [documentation](https://docs.sylabs.io/guides/3.10/admin-guide/admin_quickstart.html). + +> Note: Singularity is also available through [Anaconda](https://anaconda.org/conda-forge/singularity). + +> Note: Alternatively, Docker can be used in place of Singularity. To get started with Docker, see the [Docker CE installation documentation](https://docs.docker.com/engine/install/). + +
+ +--- + +### 2. Download the workflow files + +All files required for utilizing the NF_MGIllumina GeneLab workflow for processing metagenomics Illumina data are in the [workflow_code](workflow_code) directory. To get a copy of latest *NF_MGIllumina* version on to your system, the code can be downloaded as a zip file from the release page then unzipped after downloading by running the following commands: + +```bash +wget https://github.com/nasa/GeneLab_Data_Processing/releases/download/NF_MGIllumina_1.0.0/NF_MGIllumina_1.0.0.zip +unzip NF_MGIllumina_1.0.0.zip && cd NF_MGIllumina_1.0.0 +``` + +
+ +--- + +### 3. Fetch Singularity Images + +Although Nextflow can fetch Singularity images from a url, doing so may cause issues as detailed [here](https://github.com/nextflow-io/nextflow/issues/1210). + +To avoid this issue, run the following command to fetch the Singularity images prior to running the NF_MGIllumina workflow: + +> Note: This command should be run from within the `NF_MGIllumina_1.0.0` directory that was downloaded in [step 2](#2-download-the-workflow-files) above. + +```bash +bash ./bin/prepull_singularity.sh nextflow.config +``` + +Once complete, a `singularity` folder containing the Singularity images will be created. Run the following command to export this folder as a Nextflow configuration environment variable to ensure Nextflow can locate the fetched images: + +```bash +export NXF_SINGULARITY_CACHEDIR=$(pwd)/singularity +``` + +
+ +--- + +### 4. Run the Workflow + +> ***Note:** All the commands in this step must be run from within the `NF_MGIllumina_1.0.0` directory that was downloaded in [step 2](#2-download-the-workflow-files) above.* + +For options and detailed help on how to run the workflow, run the following command: + +```bash +nextflow run main.nf --help +``` + +> Note: Nextflow commands use both single hyphen arguments (e.g. -help) that denote general Nextflow +arguments and double hyphen arguments (e.g. --input_file) that denote workflow specific parameters. +Take care to use the proper number of hyphens for each argument. + +
+ +#### 4a. Approach 1: Start with an OSD or GLDS accession as input + +```bash +nextflow run main.nf -resume -profile singularity --accession OSD-574 +``` + +
+ +#### 4b. Approach 2: Start with a runsheet csv file as input + +```bash +nextflow run main.nf -resume -profile singularity --input_file PE_file.csv +``` + +
+ +**Required Parameters For All Approaches:** + +* `-run main.nf` - Instructs Nextflow to run the NF_MGIllumina workflow + +* `-resume` - Resumes workflow execution using previously cached results + +* `-profile` – Specifies the configuration profile(s) to load (multiple options can be provided as a comma-separated list) + * Software environment profile options (choose one): + * `singularity` - instructs Nextflow to use Singularity container environments + * `docker` - instructs Nextflow to use Docker container environments + * `conda` - instructs Nextflow to use conda environments via the conda package manager. By default, Nextflow will create environments at runtime using the yaml files in the [workflow_code/envs](workflow_code/envs/) folder. You can change this behavior by using the `--conda_*` workflow parameters or by editing the [nextflow.config](workflow_code/nextflow.config) file to specify a centralized conda environments directory via the `conda.cacheDir` parameter + * `mamba` - instructs Nextflow to use conda environments via the mamba package manager. + * Other option (can be combined with the software environment option above): + * `slurm` - instructs Nextflow to use the [Slurm cluster management and job scheduling system](https://slurm.schedmd.com/overview.html) to schedule and run the jobs on a Slurm HPC cluster. + +* `--accession` – A Genelab / OSD accession number e.g. OSD-574. + > *Required only if you would like to download and process data directly from OSDR* + +* `--input_file` – A single-end or paired-end runsheet csv file containing assay metadata for each sample, including sample_id, forward, reverse, and/or paired. Please see the [runsheet documentation](./examples/runsheet) in this repository for examples on how to format this file. + > *Required only if `--accession` is not passed as an argument* + +
+ +> See `nextflow run -h` and [Nextflow's CLI run command documentation](https://nextflow.io/docs/latest/cli.html#run) for more options and details on how to run Nextflow. +> For additional information on editing the `nextflow.config` file, see [Step 4d](#4d-modify-parameters-and-cpu-resources-in-the-nextflow-config-file) below. + + +
+ +#### 4c. Modify parameters and compute resources in the Nextflow config file + +Additionally, all parameters and workflow resources can be directly specified in the [nextflow.config](./workflow_code/nextflow.config) file. For detailed instructions on how to modify and set parameters in the config file, please see the [documentation here](https://www.nextflow.io/docs/latest/config.html). + +Once you've downloaded the workflow template, you can modify the parameters in the `params` scope and cpus/memory requirements in the `process` scope in your downloaded version of the [nextflow.config](workflow_code/nextflow.config) file as needed in order to match your dataset and system setup. Additionally, if necessary, you can modify each variable in the [nextflow.config](workflow_code/nextflow.config) file to be consistent with the study you want to process and the computer you're using for processing. + +
+ +--- + +### 5. Workflow outputs + +#### 5a. Main outputs + +> Note: The outputs from the GeneLab Illumina metagenomics sequencing data processing pipeline workflow are documented in the [GL-DPPD-7107-A.md](../../Pipeline_GL-DPPD-7107_Versions/GL-DPPD-7107-A.md) processing protocol. + +#### 5b. Resource logs + +Standard Nextflow resource usage logs are also produced as follows: + +**Nextflow Resource Usage Logs** + - Output: + - Resource_Usage/execution_report_{timestamp}.html (an html report that includes metrics about the workflow execution including computational resources and exact workflow process commands) + - Resource_Usage/execution_timeline_{timestamp}.html (an html timeline for all processes executed in the workflow) + - Resource_Usage/execution_trace_{timestamp}.txt (an execution tracing file that contains information about each process executed in the workflow, including: submission time, start time, completion time, cpu and memory used, machine-readable output) + +> Further details about these logs can also found within [this Nextflow documentation page](https://www.nextflow.io/docs/latest/tracing.html#execution-report). + +
+ +--- + +### 6. Post Processing + +The post-processing workflow generates a README file, a protocols file, an md5sums +table, and a file association table suitable for uploading to OSDR. + +For options and detailed help on how to run the post-processing workflow, run the following command: + +```bash +nextflow run post_processing.nf --help +``` + +To generate the post-processing files after running the main processing workflow successfully, modify and set the parameters in [post_processing.config](workflow_code/post_processing.config), then run the following command: + +```bash +nextflow -C post_processing.config run post_processing.nf -resume -profile singularity +``` + +The outputs of the post-processing workflow are described below: + +**Post processing workflow** + - Output: + - Post_processing/FastQC_Outputs/filtered_multiqc_GLmetagenomics_report.zip (Filtered sequence multiqc report with paths purged) + - Post_processing/FastQC_Outputs/raw_multiqc_GLmetagenomics_report.zip (Raw sequence multiqc report with paths purged) + - Post_processing/_-associated-file-names.tsv (File association table for curation) + - Post_processing/_metagenomics-validation.log (Automated verification and validation log file) + - Post_processing/processed_md5sum_GLmetagenomics.tsv (md5sums for the files to be released on OSDR) + - Post_processing/processing_info_GLmetagenomics.zip (Zip file containing all files used to run the workflow and required logs with paths purged) + - Post_processing/protocol.txt (File describing the methods used by the workflow) + - Post_processing/README_GLmetagenomics.txt (README file listing and describing the outputs of the workflow) + diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/examples/runsheet/README.md b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/examples/runsheet/README.md new file mode 100644 index 000000000..b91ea2a34 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/examples/runsheet/README.md @@ -0,0 +1,23 @@ +# Runsheet File Specification + +## Description + +* The runsheet is a comma-separated file that contains the metadata required for processing +metagenomics sequence datasets through the GeneLab Illumina metagenomics sequencing data +processing pipeline (MGIllumina). + + +## Examples + +1. Runsheet for an example [paired-end dataset](paired_end_dataset/PE_file.csv) +2. Runsheet for an example [single-end dataset](single_end_dataset/SE_file.csv) + + +## Required columns + +| Column Name | Type | Description | Example | +|:------------|:-----|:------------|:--------| +| sample_id | string | Unique Sample Name, added as a prefix to sample-specific processed data output files. Should not include spaces or weird characters. | RR23_FCS_FLT_F1 | +| forward | string (local path) | Location of the raw reads file. For paired-end data, this specifies the forward reads fastq.gz file. | /my/data/sample1_R1_HRremoved_raw.fastq.gz | +| reverse | string (local path) | Location of the raw reads file. For paired-end data, this specifies the reverse reads fastq.gz file. For single-end data, this column should be omitted. | /my/data/sample1_R2_HRremoved_raw.fastq.gz | +| paired | bool | Set to True if the samples were sequenced as paired-end. If set to False, samples are assumed to be single-end. | False | \ No newline at end of file diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/examples/runsheet/paired_end_dataset/PE_file.csv b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/examples/runsheet/paired_end_dataset/PE_file.csv new file mode 100644 index 000000000..06cdd9867 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/examples/runsheet/paired_end_dataset/PE_file.csv @@ -0,0 +1,28 @@ +sample_id,forward,reverse,paired +RR23_FCS_FLT_F1,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F1_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F1_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_FLT_F2,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F2_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F2_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_FLT_F3,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F3_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F3_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_FLT_F4,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F4_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F4_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_FLT_F5,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F5_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F5_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_FLT_F6,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F6_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F6_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_FLT_F7,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F7_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F7_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_FLT_F8,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F8_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F8_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_FLT_F9,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F9_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F9_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_GC_G1,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G1_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G1_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_GC_G2,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G2_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G2_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_GC_G3,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G3_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G3_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_GC_G4,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G4_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G4_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_GC_G5,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G5_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G5_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_GC_G6,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G6_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G6_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_GC_G7,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G7_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G7_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_GC_G8,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G8_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G8_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_GC_G9,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G9_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G9_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_VIV_V1,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V1_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V1_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_VIV_V2,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V2_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V2_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_VIV_V3,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V3_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V3_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_VIV_V4,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V4_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V4_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_VIV_V5,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V5_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V5_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_VIV_V6,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V6_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V6_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_VIV_V7,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V7_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V7_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_VIV_V8,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V8_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V8_R2_HRremoved_raw.fastq.gz,true +RR23_FCS_VIV_V9,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V9_R1_HRremoved_raw.fastq.gz,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V9_R2_HRremoved_raw.fastq.gz,true diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/examples/runsheet/single_end_dataset/SE_file.csv b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/examples/runsheet/single_end_dataset/SE_file.csv new file mode 100644 index 000000000..50eace60c --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/examples/runsheet/single_end_dataset/SE_file.csv @@ -0,0 +1,28 @@ +sample_id,forward,paired +RR23_FCS_FLT_F1,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F1_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_FLT_F2,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F2_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_FLT_F3,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F3_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_FLT_F4,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F4_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_FLT_F5,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F5_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_FLT_F6,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F6_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_FLT_F7,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F7_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_FLT_F8,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F8_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_FLT_F9,/path/to/Raw_Sequence_Data/RR23_FCS_FLT_F9_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_GC_G1,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G1_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_GC_G2,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G2_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_GC_G3,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G3_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_GC_G4,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G4_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_GC_G5,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G5_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_GC_G6,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G6_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_GC_G7,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G7_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_GC_G8,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G8_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_GC_G9,/path/to/Raw_Sequence_Data/RR23_FCS_GC_G9_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_VIV_V1,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V1_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_VIV_V2,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V2_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_VIV_V3,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V3_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_VIV_V4,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V4_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_VIV_V5,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V5_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_VIV_V6,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V6_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_VIV_V7,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V7_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_VIV_V8,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V8_R1_HRremoved_raw.fastq.gz,false +RR23_FCS_VIV_V9,/path/to/Raw_Sequence_Data/RR23_FCS_VIV_V9_R1_HRremoved_raw.fastq.gz,false \ No newline at end of file diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/GL-gen-metagenomics-file-associations-table b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/GL-gen-metagenomics-file-associations-table new file mode 100755 index 000000000..f3d93281d --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/GL-gen-metagenomics-file-associations-table @@ -0,0 +1,641 @@ +#!/usr/bin/env python + +""" +This is a program for generating the file-associations table needed by Curation for newly processed metagenomics datasets. +""" + +import os +import sys +import argparse +import textwrap +import pandas as pd +import zipfile +import re + +parser = argparse.ArgumentParser(description = "This program generates the file-assocations table needed by Curation for \ + newly processed metagenomics datasets. It is intended to be run after `GL-validate-processed-data` \ + has been run successfully.") +required = parser.add_argument_group('required arguments') +required.add_argument("-g", "--GLDS-ID", help = 'GLDS ID (e.g. "GLDS-276")', action = "store", required = True) +parser.add_argument("-i", "--isa-zip", help = "Appropriate ISA file for dataset (a zip archive, providing this will assume there is only one a_*amplicon* assay table in there, \ + if that's not the case, explicitly provide the assay table to the '-a' argument instead)", + action = "store", default = "") +parser.add_argument("--assay-table", + help = 'Appropriate assay table for dataset (this can be provided directly instead of being pulled from an ISA object)', + action = "store", default = "") +parser.add_argument("--runsheet", + help = """ + Input csv runsheet file used to run nextflow. This argument must be set when running the workflow with an OSD/GLDS accession as input as opposed to passing an input csv file. + This argument is used to get raw input file names that are used to retrieve raw read depths paer sample. + """, + action = "store", default = "") + +parser.add_argument("--output", + help = 'Name of output log file (default: "_[]-associated-file-names.tsv", with appended prefix if one is provided)', + default = "", action = "store") +parser.add_argument("-p", "--output-prefix", help = "Output additional file prefix if there is one", action = "store", default = "") +parser.add_argument("--additional-string-to-remove-from-unique-filenames", + help = "If there is any additional text to remove from unqiue filenames, it can be provided here.", + action = "store") +parser.add_argument("--assay_suffix", help = "Genelab assay suffix", action = "store", default = "_GLmetagenomics") +parser.add_argument("--raw_file_prefix", help = "Prefix to be added to the raw data files alone (Default: _metagenomics_)", action = "store", default ="") +parser.add_argument("--file_prefix", help = "Prefix to be added to all files except the raw files (Default: _GLmetagenomics_)", action = "store", default ="") +parser.add_argument("--raw_suffix", help = "Raw reads suffix", action = "store", default ="_HRremoved_raw.fastq.gz") +parser.add_argument("--raw_R1_suffix", help = "Raw forward reads suffix", action = "store", default = "_R1_HRremoved_raw.fastq.gz") +parser.add_argument("--raw_R2_suffix", help = "Raw reverse reads suffix", action = "store", default = "_R2_HRremoved_raw.fastq.gz") +parser.add_argument("--filtered_suffix", help = "Filtered reads suffix", action = "store", default = "_filtered.fastq.gz") +parser.add_argument("--filtered_R1_suffix", help = "Filtered forward reads suffix", action = "store", default = "_R1_filtered.fastq.gz") +parser.add_argument("--filtered_R2_suffix", help = "Filtered reverse reads suffix", action = "store", default = "_R2_filtered.fastq.gz") +parser.add_argument("--processing_zip_file", help = "Specifies the name of processing_info.zip", + action = "store", default = "processing_info.zip") +parser.add_argument("--readme", help = "Specifies the name of README.txt", + action = "store", default = "README.txt") +parser.add_argument("--raw_reads_dir", help = "Specifies the name of the raw reads directory if they are to be included", + action = "store", default = "Raw_Sequence_Data/") +parser.add_argument("--fastqc_dir", help = "Specifies the location of fastqc and multiqc reports directory", + action = "store", default = "FastQC_Outputs/") +parser.add_argument("--filtered_reads_dir", help = "Specifies the name of the filtered reads directory", + action = "store", default = "Filtered_Sequence_Data/") +parser.add_argument("--read_based_dir", help = "Specifies the location of the directory containing results generated from read-based processing approach", + action = "store", default = "Read-based_Processing/") +parser.add_argument("--assembly_based_dir", help = "Specifies the location of the directory containing results generated from assembly-based approach", + action = "store", default = "Assembly-based_Processing/") +parser.add_argument("--assemblies_dir", help = "Specifies the location of the directory containing sample contig assemblies", + action = "store", default = "Assembly-based_Processing/assemblies/") +parser.add_argument("--genes_dir", help = "Specifies the location of the directory containing predicted genes", + action = "store", default = "Assembly-based_Processing/predicted-genes/") +parser.add_argument("--annotations_and_tax_dir", help = "Specifies the location of the directory containing contigs annotation and taxonomy", + action = "store", default = "Assembly-based_Processing/annotations-and-taxonomy/") +parser.add_argument("--mapping_dir", help = "Specifies the location of the directory containing per-sample bam, coverage, and mapping info files", + action = "store", default = "Assembly-based_Processing/read-mapping/") +parser.add_argument("--bins_dir", help = "Specifies the location of the directory containing recovered genome bins", + action = "store", default = "Assembly-based_Processing/bins/") +parser.add_argument("--MAGs_dir", help = "Specifies the location of the directory containing meta-assembled genomes (MAGs)", + action = "store", default = "Assembly-based_Processing/MAGs/") +parser.add_argument("--combined_output_dir", help = "Specifies the location of the directory containing contig annotation summary outputs with all samples combined", + action = "store", default = "Assembly-based_Processing/combined-outputs/") +parser.add_argument("--single-ended", help = "Add this flag if data are single-end sequencing.", action = "store_true") +parser.add_argument("--R1-used-as-single-ended-data", help = "Provide this flag if processing only R1 reads as single-end (as the expected raw \ + filename suffixes will have 'R1' in there)", + action = "store_true") +parser.add_argument("--include-raw-multiqc-in-output", + help = "Provide this flag if wanting to include the raw multiqc zip in the file-associations output table (may be wanted for older datasets)", + action = "store_true") +parser.add_argument("--use-sample-names-from-assay-table", + help = "Provide this flag if the unique filename strings in the processed outputs are taken directly from the \ + 'Sample Name' column of the input assay table.", action = "store_true") + + +if len(sys.argv)==1: + parser.print_help(sys.stderr) + sys.exit(0) + +args = parser.parse_args() + + +# Setting some colors +tty_colors = { + 'green' : '\033[0;32m%s\033[0m', + 'yellow' : '\033[0;33m%s\033[0m', + 'red' : '\033[0;31m%s\033[0m' +} + + +######################### Aesthetic functions ######################### +def color_text(text, color='green'): + if sys.stdout.isatty(): + return tty_colors[color] % text + else: + return text + + +def wprint(text): + """ Print wrapper """ + + print(textwrap.fill(text, width=80, initial_indent=" ", + subsequent_indent=" ", break_on_hyphens=False)) + + +def modify_symbolic_link(file_path): + """ Modify symbolic link such that it retruns a string containing the parent dir and the base name""" + full_path = os.path.realpath(file_path) + parent_dir = os.path.basename(os.path.dirname(full_path)) + base_name = os.path.basename(full_path) + mod_path = os.path.join(parent_dir, base_name) + return(mod_path.replace("_", " ").rstrip("/")) + + +#################### End of Aesthetic functions ######################### + + +def report_failure(message, color = "yellow"): + print("") + wprint(color_text(message, color)) + print("\nCuration file-associations table generation failed.\n") + sys.exit(1) + + +def preflight_checks(isa_zip, assay_table): + """Check that either one of isa_zip or assay_table is passed as argument""" + # Ensure that at least one of isa_zip or assay_table is passed as argument + if isa_zip == "" and assay_table == "": + report_failure("This program requires either an input ISA object (passed to '-i') or a specific assay table (passed to '-a').") + # Ensure that only one of isa_zip or assay_table is passed as argument + if isa_zip != "" and assay_table != "": + report_failure("This program requires *only* an input ISA object (passed to '-i') or a specific assay table (passed to '-a'), not both.") + + +def check_for_file_and_contents(file_path): + """Checks if file exists and that it is not empty""" + if not os.path.exists(file_path): + report_failure("The expected file '" + str(file_path) + "' does not exist.") + if not os.path.getsize(file_path) > 0: + report_failure("The file '" + str(file_path) + "' is empty.") + + +def get_assay_table_from_ISA(isa_zip): + """ Tries to find a single assay table in an isa object """ + + zip_file = zipfile.ZipFile(isa_zip) + isa_files = zip_file.namelist() + + # Getting wanted filename (those that start with "a_" and contains the word "metagenomic" seem to be what we want) + wanted_file_list = [item for item in isa_files if item.startswith("a_") and item.find("metagenomic") != -1] + if len(wanted_file_list) != 1: + report_failure("We couldn't find the correct assay table in the ISA object, consider passing it directly to the '-a' argument.") + + wanted_file = wanted_file_list[0] + + df = pd.read_csv(zip_file.open(wanted_file), sep = "\t") + + return(df) + + +def get_assay_table(isa_zip, assay_table): + """ Returns the assay table whether provided directly or pulled from ISA archive """ + + # Get assay table if we are using an input isa object + if isa_zip != "": + # Check if ISA exists and thet it isn't empty + check_for_file_and_contents(isa_zip) + + assay_table_df = get_assay_table_from_ISA(isa_zip) + + # Reading assay table if provided directly + else: + # Check if assay_table exists and that it isn't empty + check_for_file_and_contents(assay_table) + assay_table_df = pd.read_csv(assay_table, sep = "\t") + + return(assay_table_df) + + +def remove_suffixes(name, raw_file_prefix, raw_R1_suffix, raw_R2_suffix, raw_suffix): + """ This removes expected prefixes and suffixes """ + + # Removing expected prefix + curr_name = name.replace(raw_file_prefix, "") + + # Removing potential suffixes (also checking R2 in case they are not + # in the appropriate order in the sample table, e.g. R2 before R1) + curr_name = curr_name.replace(raw_R1_suffix, "") + curr_name = curr_name.replace(raw_R2_suffix, "") + curr_name = curr_name.replace(raw_suffix, "") + + return(curr_name) + +def get_sample_names_and_unique_filenames(assay_table, raw_file_prefix, raw_R1_suffix, + raw_R2_suffix, raw_suffix, + use_sample_names_from_assay_table, + additional_string_to_remove_from_unique_filenames): + """ + This gets the sample names ('Sample Name' column) from the assay table, + and tries to get what would have been the unique filename prefixes generated from + what's in the Raw Data File column of the assay table. + + Unless the --use-sample-names-from-assay-table flag was provided, then it just uses what's + in the 'Sample Name' column. + """ + + sample_names = assay_table["Sample Name"].tolist() + + if use_sample_names_from_assay_table: + unique_filename_prefixes = sample_names + return(sample_names, unique_filename_prefixes) + + all_filenames = assay_table["Raw Data File"] + + unique_filename_prefixes = [] + + # Attempting to split if they have multiple files (like paired-end) + # and also removing the common prefixes and suffixes intending to create the same + # unique filenames used for processing + + for entry in all_filenames: + + # splitting if there are more than one (like with paired-end) + curr_name = entry.split(",")[0] + + curr_name = remove_suffixes(curr_name, raw_file_prefix, raw_R1_suffix, raw_R2_suffix, raw_suffix) + + unique_filename_prefixes.append(curr_name) + + + if additional_string_to_remove_from_unique_filenames: + + unique_filename_prefixes = [x.replace(additional_string_to_remove_from_unique_filenames, "") for x in unique_filename_prefixes] + + return(sample_names, unique_filename_prefixes) + + +def get_read_counts_from_raw_multiqc(raw_multiqc_stats_file_path, + fastqc_dir, output_prefix, raw_multiqc_zip): + + input_zip = os.path.join(fastqc_dir, output_prefix + raw_multiqc_zip) + zip_file = zipfile.ZipFile(input_zip) + df = pd.read_csv(zip_file.open(raw_multiqc_stats_file_path), sep = "\t", usecols = [0,6]) + df.columns = ["sample", "counts"] + df.set_index("sample", inplace = True) + + return(df) + + +def get_read_count_from_df(sample_name, read_counts_tab, + raw_suffix, raw_R1_suffix, single_ended, sample_raw_prefix_dict): + + if sample_raw_prefix_dict != "": + return(round(read_counts_tab.at[sample_raw_prefix_dict[sample_name], "counts"])) + + if single_ended: + return(round(read_counts_tab.at[str(sample_name) + \ + raw_suffix.replace("_raw.fastq.gz", ""), "counts"])) + else: + return(round(read_counts_tab.at[str(sample_name) + \ + raw_R1_suffix.replace("_raw.fastq.gz", ""), "counts"])) + + + +def write_colnames(raw_reads_dir, filtered_reads_dir, fastqc_dir, + assembly_based_dir, assemblies_dir, genes_dir, + annotations_and_tax_dir, mapping_dir, bins_dir, + MAGs_dir, combined_output_dir, read_based_dir): + """ Function to write the required column names""" + + # Get Parent directory and tag it unto the base directory name to confirm with what we expect as column headers + # for sundirectory outputs + assemblies_dir = modify_symbolic_link(assemblies_dir) if os.path.islink(assemblies_dir) else assemblies_dir.replace("_", " ").rstrip("/") + genes_dir = modify_symbolic_link(genes_dir) if os.path.islink(genes_dir) else genes_dir.replace("_", " ").rstrip("/") + annotations_and_tax_dir = modify_symbolic_link(annotations_and_tax_dir) if os.path.islink(annotations_and_tax_dir) else annotations_and_tax_dir.replace("_", " ").rstrip("/") + mapping_dir = modify_symbolic_link(mapping_dir) if os.path.islink(mapping_dir) else mapping_dir.replace("_", " ").rstrip("/") + bins_dir = modify_symbolic_link(bins_dir) if os.path.islink(bins_dir) else bins_dir.replace("_", " ").rstrip("/") + MAGs_dir = modify_symbolic_link(MAGs_dir) if os.path.islink(MAGs_dir) else MAGs_dir.replace("_", " ").rstrip("/") + combined_output_dir = modify_symbolic_link(combined_output_dir) if os.path.islink(combined_output_dir) else combined_output_dir.replace("_", " ").rstrip("/") + + + colnames = ["Sample Name", + "Parameter Value[README]", + f"Parameter Value[{raw_reads_dir}]", + "Parameter Value[Read Depth]", + "Unit", + f"Parameter Value[{filtered_reads_dir}]", + f"Parameter Value[{fastqc_dir}]", + f"Parameter Value[{assembly_based_dir}]", + f"Parameter Value[{assemblies_dir}]", + f"Parameter Value[{genes_dir}]", + f"Parameter Value[{annotations_and_tax_dir}]", + f"Parameter Value[{mapping_dir}]", + f"Parameter Value[{bins_dir}]", + f"Parameter Value[{MAGs_dir}]", + f"Parameter Value[{combined_output_dir}]", + f"Parameter Value[{read_based_dir}]", + "Parameter Value[Processing Info]"] + return colnames + + + +def create_constants(include_raw_multiqc_in_output, raw_multiqc_zip, + filtered_multiqc_zip, combined_prefix, assay_suffix): + """A function to create lists of contants to be in creating a file association table""" + if include_raw_multiqc_in_output: + fastqc = [combined_prefix + raw_multiqc_zip, + combined_prefix + filtered_multiqc_zip] + else: + fastqc = [combined_prefix + filtered_multiqc_zip] + + combined_outputs = [combined_prefix + f"Combined-gene-level-KO-function-coverages{assay_suffix}.tsv", + combined_prefix + f"Combined-gene-level-KO-function-coverages-CPM{assay_suffix}.tsv", + combined_prefix + f"Combined-gene-level-taxonomy-coverages{assay_suffix}.tsv", + combined_prefix + f"Combined-gene-level-taxonomy-coverages-CPM{assay_suffix}.tsv", + combined_prefix + f"Combined-contig-level-taxonomy-coverages{assay_suffix}.tsv", + combined_prefix + f"Combined-contig-level-taxonomy-coverages-CPM{assay_suffix}.tsv"] + + read_based_outputs = [combined_prefix + f"Gene-families{assay_suffix}.tsv", + combined_prefix + f"Gene-families-grouped-by-taxa{assay_suffix}.tsv", + combined_prefix + f"Gene-families-cpm{assay_suffix}.tsv", + combined_prefix + f"Gene-families-KO-cpm{assay_suffix}.tsv", + combined_prefix + f"Pathway-abundances{assay_suffix}.tsv", + combined_prefix + f"Pathway-abundances-grouped-by-taxa{assay_suffix}.tsv", + combined_prefix + f"Pathway-abundances-cpm{assay_suffix}.tsv", + combined_prefix + f"Pathway-coverages{assay_suffix}.tsv", + combined_prefix + f"Pathway-coverages-grouped-by-taxa{assay_suffix}.tsv", + combined_prefix + f"Metaphlan-taxonomy{assay_suffix}.tsv"] + + return fastqc, combined_outputs, read_based_outputs + +def rusheet_to_dict(runsheet): + """ Reads the input nextflow runsheet into a dataframe and converts it to + a dictionary with sample names as keys and raw reads forward prefix used + by multiqc as values + """ + def get_prefix(string): + basename = os.path.basename(string) + index = basename.rfind("_") + return(basename[0:index]) + df = pd.read_csv(runsheet, usecols=["sample_id", "forward"]) + df['forward'] = df.forward.apply(lambda row : get_prefix(row)) + sample_to_prefix_dict = {k:v['forward'] for k,v in df.set_index("sample_id").T.to_dict().items()} + return(sample_to_prefix_dict) + +def create_association_table(header_colnames, assembly_overview_tab, fastqc, combined_outputs, read_based_outputs, + unique_filename_prefixes, read_count_tab, sample_file_dict, file_prefix, combined_prefix, + readme, assay_suffix, raw_file_prefix, raw_suffix, raw_R1_suffix, raw_R2_suffix, + filtered_suffix, filtered_R1_suffix, filtered_R2_suffix, processing_info, + single_ended, R1_used_as_single_ended_data, assemblies_dir, assembly_suffix, assembly_files, + genes_dir, mapping_dir, bins_overview, bins_dir_files, MAGs_overview, MAGs_dir_files, + MAG_KO_files_list, sample_raw_prefix_dict, read_count_unit = "read"): + """Create association table and add data rows to it""" + + # Initialize association table + association_df = pd.DataFrame(columns = header_colnames) + filtered_reads_count = combined_prefix + f"filtered-read-counts{assay_suffix}.tsv" + # Create row + for sample in unique_filename_prefixes: + if sample_raw_prefix_dict != "": + # This expects that sample input fastq files will always end with + # HRremoved. if they don't, then you have to modify these hard coded strings. + if (single_ended and R1_used_as_single_ended_data) or (not single_ended): + raw_sample_name = re.sub("_R1_HRremoved$","", sample_raw_prefix_dict[sample]) + else: + raw_sample_name = re.sub("_HRremoved$","", sample_raw_prefix_dict[sample]) + # Single-end (Paired-end data where only the forward reads were analyzed) + if single_ended and R1_used_as_single_ended_data: + # If only forward read was used, still want to include both foward and reverse read names + # in the "Raw Data" column because it is tied to the hosted raw data, not just what was used here + curr_raw_data = [raw_file_prefix + sample + raw_R1_suffix, + raw_file_prefix + sample + raw_R2_suffix] + + if sample_raw_prefix_dict != "": + curr_raw_data = [raw_sample_name + raw_R1_suffix, raw_sample_name + raw_R2_suffix] + + curr_filt_data = [file_prefix + sample + filtered_R1_suffix, + filtered_reads_count] + # Single-end without reverse reads + elif single_ended: + curr_raw_data = [raw_file_prefix + sample + raw_suffix] + + if sample_raw_prefix_dict != "": + curr_raw_data = [raw_sample_name + raw_suffix] + + + curr_filt_data = [file_prefix + sample + filtered_suffix, + filtered_reads_count] + # Paired-end + else: + curr_raw_data = [raw_file_prefix + sample + raw_R1_suffix, + raw_file_prefix + sample + raw_R2_suffix] + + if sample_raw_prefix_dict != "": + curr_raw_data = [raw_sample_name + raw_R1_suffix, raw_sample_name + raw_R2_suffix] + + curr_filt_data = [file_prefix + sample + filtered_R1_suffix, + file_prefix + sample + filtered_R2_suffix, + filtered_reads_count] + # Get sample raw read count + curr_read_count = get_read_count_from_df(sample, read_count_tab, raw_suffix, + raw_R1_suffix, single_ended, sample_raw_prefix_dict) + + read_count_tab['samples'] = read_count_tab.index + contains_sample = read_count_tab['samples'].str.contains + # Only adding file to list if it exists and isn't empty (easier for curation this way) + curr_path = os.path.join(assemblies_dir, sample + assembly_suffix) + + if os.path.exists(curr_path) and os.path.getsize(curr_path) > 0: + curr_assembly = [file_prefix + sample + assembly_suffix] + assembly_files + else: + curr_assembly = [""] + + # Only adding file to list if it exists and isn't empty (easier for curation this way) + curr_genes = [] + gene_suffixes = ["-genes.faa", "-genes.fasta", "-genes.gff"] + for ext in gene_suffixes: + curr_path = os.path.join(genes_dir, sample + ext) + + if os.path.exists(curr_path) and os.path.getsize(curr_path) > 0: + curr_genes.append(file_prefix + sample + ext) + + # Adding empty value if all 3 missing (which i don't think happens as the gff has content either way) + if len(curr_genes) == 0: + curr_genes = [""] + + # These have headers even if no data for a sample, so no complications about being empty + curr_annots = [file_prefix + sample + "-gene-coverage-annotation-and-tax.tsv", + file_prefix + sample + "-contig-coverage-and-tax.tsv"] + + # Only adding file to list if it exists and isn't empty (easier for curation this way) + curr_read_mapping = [] + mapping_suffixes = [".bam", "-mapping-info.txt", "-metabat-assembly-depth.tsv"] + for ext in mapping_suffixes: + curr_path = os.path.join(mapping_dir, sample + ext) + + if os.path.exists(curr_path) and os.path.getsize(curr_path) > 0: + curr_read_mapping.append(file_prefix + sample + ext) + + # Adding empty value if all 3 missing + if len(curr_read_mapping) == 0: + curr_read_mapping = [""] + + if bins_overview[0] == f"{combined_prefix}bins-overview{assay_suffix}.tsv": + curr_bins = bins_overview + [file_prefix + file for file in bins_dir_files if file.startswith(sample)] + else: + curr_bins = [""] + + if MAGs_overview[0] == f"{combined_prefix}MAGs-overview{assay_suffix}.tsv": + curr_MAGs = MAGs_overview + [file_prefix + file for file in MAGs_dir_files if file.startswith(sample)] + MAG_KO_files_list + else: + curr_MAGs = [""] + + curr_row_as_list = [sample_file_dict[sample], + readme, + ", ".join(curr_raw_data), + curr_read_count, + read_count_unit, + ", ".join(curr_filt_data), + ", ".join(fastqc), + assembly_overview_tab, + ", ".join(curr_assembly), + ", ".join(curr_genes), + ", ".join(curr_annots), + ", ".join(curr_read_mapping), + ", ".join(curr_bins), + ", ".join(curr_MAGs), + ", ".join(combined_outputs), + ", ".join(read_based_outputs), + processing_info] + + # Append row to the association dataframe + association_df.loc[len(association_df)] = curr_row_as_list + + return association_df + + + +def write_association_table(outfile, association_df): + """Write to csv file""" + # Writing out + association_df.to_csv(outfile, sep = "\t", index = False) + + +def main(): + + ### Set variables ### + # Directories + fastqc_dir = str(args.fastqc_dir) + raw_reads_dir = str(args.raw_reads_dir) + filtered_reads_dir = str(args.filtered_reads_dir) + assembly_based_dir = str(args.assembly_based_dir) + assemblies_dir = str(args.assemblies_dir) + genes_dir = str(args.genes_dir) + annotations_and_tax_dir = str(args.annotations_and_tax_dir) + mapping_dir = str(args.mapping_dir) + bins_dir = str(args.bins_dir) + MAGs_dir = str(args.MAGs_dir) + combined_output_dir = str(args.combined_output_dir) + read_based_dir = str(args.read_based_dir) + + raw_reads_dir = raw_reads_dir.replace("_", " ").rstrip("/") + filtered_reads_dir = filtered_reads_dir.replace("_", " ").rstrip("/") + assembly_based_dir = assembly_based_dir.replace("_", " ").rstrip("/") + annotations_and_tax_dir = annotations_and_tax_dir.replace("_", " ").rstrip("/") + combined_output_dir = combined_output_dir.replace("_", " ").rstrip("/") + read_based_dir = read_based_dir.replace("_", " ").rstrip("/") + fastqc_dir = fastqc_dir.replace("_", " ").rstrip("/") + + + # Suffixes + filtered_suffix = str(args.filtered_suffix) + filtered_R1_suffix = str(args.filtered_R1_suffix) + filtered_R2_suffix = str(args.filtered_R2_suffix) + raw_suffix = str(args.raw_suffix) + raw_R1_suffix = str(args.raw_R1_suffix) + raw_R2_suffix = str(args.raw_R2_suffix) + if args.R1_used_as_single_ended_data: + raw_suffix = raw_R1_suffix + # Just in case user only specified --R1-used-as-single-ended, but didn't specify --single-ended + args.single_ended = True + assay_suffix = str(args.assay_suffix) + assembly_suffix = "-assembly.fasta" + + # This one is only used for the raw data files + raw_file_prefix = f"{args.GLDS_ID}_metagenomics_" if args.raw_file_prefix == "" else str(args.raw_file_prefix) + file_prefix = f"{args.GLDS_ID}_GMetagenomics_" if args.file_prefix == "" else str(args.file_prefix) + raw_multiqc_zip = f"raw_multiqc{assay_suffix}_report.zip" + filtered_multiqc_zip = f"filtered_multiqc{assay_suffix}_report.zip" + output_prefix = str(args.output_prefix) + combined_prefix = file_prefix + output_prefix + raw_multiqc_stats_file_path = output_prefix + f"raw_multiqc_report.zip".split(".")[0] + \ + f"/{output_prefix}raw_multiqc_data/multiqc_general_stats.txt" + processing_info = combined_prefix + str(args.processing_zip_file) + + assembly_overview_tab = f"{combined_prefix}Assembly-based-processing-overview{assay_suffix}.tsv" + failed_assemblies = os.path.join(args.assemblies_dir, f"{output_prefix}Failed-assemblies{assay_suffix}.tsv") + bins_overview_tab = os.path.join(args.bins_dir, f"{output_prefix}bins-overview{assay_suffix}.tsv") + mags_overview_tab = os.path.join(args.MAGs_dir,f"{output_prefix}MAGs-overview{assay_suffix}.tsv") + mag_ko_annotation = os.path.join(args.MAGs_dir, f"{output_prefix}MAG-level-KO-annotations{assay_suffix}.tsv") + mag_kegg_tab = os.path.join(args.MAGs_dir, f"{output_prefix}MAG-KEGG-Decoder-out{assay_suffix}.tsv") + mag_kegg_html = os.path.join(args.MAGs_dir, f"{output_prefix}MAG-KEGG-Decoder-out{assay_suffix}.html") + + + # Set output file name + if args.output == "" and output_prefix != "": + outfile = f"{args.GLDS_ID}_{output_prefix}-associated-file-names.tsv" + elif args.output == "": + outfile = f"{args.GLDS_ID}-associated-file-names.tsv" + else: + outfile = args.output + + readme = combined_prefix + args.readme + include_raw_multiqc_in_output = str(args.include_raw_multiqc_in_output) + + + if os.path.exists(failed_assemblies): + assembly_files = [f"{combined_prefix}assembly-summaries{assay_suffix}.tsv", + f"{combined_prefix}Failed-assemblies{assay_suffix}.tsv"] + else: + assembly_files = [f"{combined_prefix}assembly-summaries{assay_suffix}.tsv"] + + if os.path.exists(bins_overview_tab): + bins_overview = [f"{combined_prefix}bins-overview{assay_suffix}.tsv"] + bins_dir_files = [file for file in os.listdir(args.bins_dir) if file.endswith(".fasta")] + else: + bins_overview = [""] + bins_dir_files = [""] + + if os.path.exists(mags_overview_tab): + MAGs_overview = [f"{combined_prefix}MAGs-overview{assay_suffix}.tsv"] + MAGs_dir_files = [file for file in os.listdir(args.MAGs_dir) if file.endswith(".fasta")] + else: + MAGs_overview = [""] + MAGs_dir_files = [""] + + MAG_KO_files_list = [] + if os.path.exists(mag_ko_annotation): + MAG_KO_files_list.append(f"{combined_prefix}MAG-level-KO-annotations{assay_suffix}.tsv") + if os.path.exists(mag_kegg_tab): + MAG_KO_files_list.append(f"{combined_prefix}MAG-KEGG-Decoder-out{assay_suffix}.tsv") + if os.path.exists(mag_kegg_html): + MAG_KO_files_list.append(f"{combined_prefix}MAG-KEGG-Decoder-out{assay_suffix}.html") + + + # Check that either of ISA zip or assay table is passed as argument + preflight_checks(args.isa_zip, args.assay_table) + + assay_table = get_assay_table(args.isa_zip, args.assay_table) + + sample_names, unique_filename_prefixes = get_sample_names_and_unique_filenames(assay_table, raw_file_prefix, raw_R1_suffix, + raw_R2_suffix, raw_suffix, + args.use_sample_names_from_assay_table, + args.additional_string_to_remove_from_unique_filenames) + + sample_file_dict = dict(zip(unique_filename_prefixes, sample_names)) + + read_counts_df = get_read_counts_from_raw_multiqc(raw_multiqc_stats_file_path, args.fastqc_dir, + output_prefix, raw_multiqc_zip) + + ################################### Write file association table ########################################## + header = write_colnames(raw_reads_dir, filtered_reads_dir, fastqc_dir, + assembly_based_dir, args.assemblies_dir, args.genes_dir, + args.annotations_and_tax_dir, args.mapping_dir, args.bins_dir, + args.MAGs_dir, args.combined_output_dir, read_based_dir) + + fastqc, combined_outputs, read_based_outputs = create_constants(include_raw_multiqc_in_output, raw_multiqc_zip, + filtered_multiqc_zip, combined_prefix, assay_suffix) + + + # Retrieve a dictionary with sample names as keys and raw fatqfile prefix as values + sample_raw_prefix_dict = rusheet_to_dict(args.runsheet) if args.runsheet != "" else "" + + association_df = create_association_table(header, assembly_overview_tab, fastqc, combined_outputs, read_based_outputs, + unique_filename_prefixes, read_counts_df, sample_file_dict, file_prefix, + combined_prefix,readme, assay_suffix, raw_file_prefix, raw_suffix, + raw_R1_suffix, raw_R2_suffix, filtered_suffix, filtered_R1_suffix, + filtered_R2_suffix, processing_info, args.single_ended, + args.R1_used_as_single_ended_data, args.assemblies_dir, assembly_suffix, assembly_files, + args.genes_dir, args.mapping_dir, bins_overview, bins_dir_files, MAGs_overview, + MAGs_dir_files, MAG_KO_files_list, sample_raw_prefix_dict, read_count_unit = "read") + + + write_association_table(outfile, association_df) + + +if __name__ == "__main__": + main() diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/GL-gen-processed-metagenomics-readme b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/GL-gen-processed-metagenomics-readme new file mode 100755 index 000000000..9dd6aa2d3 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/GL-gen-processed-metagenomics-readme @@ -0,0 +1,267 @@ +#!/usr/bin/env python + +""" +This is a program for generating a README.txt file for GeneLab processed metagenomics datasets. +""" + +import os +import sys +import argparse +import textwrap +import zipfile +import re + + +parser = argparse.ArgumentParser(description = "This program generates the corresponding README file for GeneLab processed amplicon dataset. It is intended to \ + be run before running `GL-validate-processed-metagenomics-data` and after processing_info.zip has been created.") + +required = parser.add_argument_group('required arguments') +required.add_argument("-g", "--GLDS-ID", help = 'GLDS ID (e.g. "GLDS-69")', action = "store", required = True) +parser.add_argument("--output", help = 'Name of output file (default: "README.txt", with appended prefix if one is provided)', default = "README.txt") +parser.add_argument("--name", help = 'Name of individual who performed the processing (default: "Michael D. Lee")', default = "Michael D. Lee") +parser.add_argument("--email", help = 'Email address of individual who performed the processing (default: "Mike.Lee@nasa.gov")', default = "Mike.Lee@nasa.gov") +parser.add_argument("--protocol_ID", help = 'Protocol document ID followed (default: assay dependent)', default = "GL-DPPD-7104-B") +parser.add_argument("-p", "--output-prefix", help = "Output additional file prefix if there is one", action = "store", default = "") +parser.add_argument("--assay_suffix", help = "Genelab assay suffix", action = "store", default = "_GLAmpSeq") +parser.add_argument("--primers-already-trimmed", help = "Add this flag if primers were trimmed prior to GeneLab processing, \ + therefore there are no trimmed sequence data", action = "store_true") +parser.add_argument("--processing_zip_file", help = "Specifies the location of processing_info.zip", + action = "store", default = "processing_info.zip") +parser.add_argument("--raw-reads-dir", help = "Specifies the location of the raw reads directory if they are to be included", action = "store", default = "") +parser.add_argument("--fastqc_dir", help = "Specifies the location of fastqc and multiqc reports directory", + action = "store", default = "FastQC_Outputs/") +parser.add_argument("--filtered_reads_dir", help = "Specifies the location of the filtered reads directory", + action = "store", default = "Filtered_Sequence_Data/") +parser.add_argument("--read_based_dir", help = "Specifies the location of the directory containing the results generated from read-based approach", + action = "store", default = "Read-based_Processing/") +parser.add_argument("--assembly_based_dir", help = "Specifies the location of the directory containing results generated from assembly-based approach", + action = "store", default = "Assembly-based_Processing/") +parser.add_argument("--assemblies_dir", help = "Specifies the location of the directory containing sample contig assemblies", + action = "store", default = "Assembly-based_Processing/assemblies/") +parser.add_argument("--genes_dir", help = "Specifies the location of the directory containing predicted genes", + action = "store", default = "Assembly-based_Processing/predicted-genes/") +parser.add_argument("--annotations_and_tax_dir", help = "Specifies the location of the directory containing contigs annotation and taxonomy", + action = "store", default = "Assembly-based_Processing/annotations-and-taxonomy/") +parser.add_argument("--mapping_dir", help = "Specifies the location of the directory containing per-sample bam, coverage, and mapping info files", + action = "store", default = "Assembly-based_Processing/read-mapping/") +parser.add_argument("--bins_dir", help = "Specifies the location of the directory containing recovered genome bins", + action = "store", default = "Assembly-based_Processing/bins/") +parser.add_argument("--MAGs_dir", help = "Specifies the location of the directory containing metaassebled genomes (MAGs)", + action = "store", default = "Assembly-based_Processing/MAGs/") +parser.add_argument("--combined_output_dir", help = "Specifies the location of the directory containing summary outputs with all samples combined", + action = "store", default = "Assembly-based_Processing/combined-outputs/") + +if len(sys.argv)==1: + parser.print_help(sys.stderr) + sys.exit(0) + +args = parser.parse_args() + +# Setting some colors +tty_colors = { + 'green' : '\033[0;32m%s\033[0m', + 'yellow' : '\033[0;33m%s\033[0m', + 'red' : '\033[0;31m%s\033[0m' +} + + +### Functions ### +def color_text(text, color='green'): + if sys.stdout.isatty(): + return tty_colors[color] % text + else: + return text + + +def wprint(text): + """ Print wrapper """ + + print(textwrap.fill(text, width=80, initial_indent=" ", + subsequent_indent=" ", break_on_hyphens=False)) + + +def report_failure(message, color = "yellow"): + print("") + wprint(color_text(message, color)) + print("\nREADME-generation failed.\n") + + sys.exit(1) + + +def check_for_file_and_contents(file_path): + """ Used by get_processing_zip_contents function """ + + if not os.path.exists(file_path): + report_failure("The expected file '" + str(file_path) + "' does not exist.") + if not os.path.getsize(file_path) > 0: + report_failure("The file '" + str(file_path) + "' is empty.") + + +def get_processing_zip_contents(processing_zip_file): + """ This gets the filenames that are in the processing_info.zip to add them to the readme """ + # Check that the zip file exists and that it is not empty + + check_for_file_and_contents(processing_zip_file) + + with zipfile.ZipFile(processing_zip_file) as zip_obj: + + entries = zip_obj.namelist() + entries.sort() + + return(entries) + + +def write_header(output, GLDS_ID, name, email, protocol_ID): + + header = ["################################################################################\n", + "{:<77} {:>0}".format("## This directory holds processed data for NASA " + str(GLDS_ID), "##\n"), + "{:<77} {:>0}".format("## https://genelab-data.ndc.nasa.gov/genelab/accession/" + str(GLDS_ID) + "/", "##\n"), + "{:<77} {:>0}".format("##", "##\n"), + "{:<77} {:>0}".format("## Processed by " + str(name) + " (" + str(email) + ")", "##\n"), + "{:<77} {:>0}".format("## Based on " + str(protocol_ID), "##\n"), + "################################################################################\n\n", + "Summary of contents:\n\n"] + + output.writelines(header) + + + +def write_metagenomics_body(output, output_file, assay_suffix, output_prefix, processing_zip_file, + processing_zip_contents, fastqc_dir, raw_reads_dir, filtered_reads_dir, + read_based_dir, assembly_based_dir, assemblies_dir, mapping_dir, genes_dir, + annotations_and_tax_dir, bins_dir, MAGs_dir, combined_output_dir): + + # this file + output.write(" {:<75} {:>0}".format("- " + str(output_file), "- this file\n\n")) + + # fastqc info + output.write(" {:<75} {:>0}".format("- " + str(fastqc_dir), "- multiQC summary reports of FastQC runs\n\n")) + + # raw reads + if raw_reads_dir != "": + output.write(" {:<75} {:>0}".format("- " + str(raw_reads_dir), "- initial read fastq files\n\n")) + + # quality-filtered reads + output.write(" {:<75} {:>0}".format("- " + str(filtered_reads_dir), "- quality-filtered fastq files\n\n")) + + # outputs + output.write(" {:<75} {:>0}".format("- " + str(assembly_based_dir), "- results generated from assembly-based approach\n\n")) + + output.write(" {:<71} {:>0}".format(f"- {output_prefix}Assembly-based-processing-overview{assay_suffix}.tsv", "- Assembly-based overview per sample\n\n")) + + output.write(" {:<71} {:>0}".format("- " + str(assemblies_dir), "- per-sample assembly files and info\n")) + output.write(" {:<67} {:>0}".format("- *-assembly.fasta", "- fasta files of individual sample assemblies\n")) + output.write(" {:<67} {:>0}".format(f"- {output_prefix}assembly-summaries{assay_suffix}.tsv", "- table of all assemblies' summary statistics\n")) + output.write(" {:<67} {:>0}".format(f"- {output_prefix}Failed-assemblies{assay_suffix}.tsv", "- samples that didn't assemble any contigs (if any)\n\n")) + + output.write(" {:<71} {:>0}".format("- " + str(genes_dir), "- per-sample predicted gene files\n")) + output.write(" {:<67} {:>0}".format("- *.faa", "- gene amino-acid sequences\n")) + output.write(" {:<67} {:>0}".format("- *.fasta", "- gene nucleotide sequences\n")) + output.write(" {:<67} {:>0}".format("- *.gff", "- predicted genes in general feature format\n\n")) + + output.write(" {:<71} {:>0}".format("- " + str(annotations_and_tax_dir), "- per-sample Kegg Orthology (KO) annotations, taxonomy, and coverages\n")) + output.write(" {:<67} {:>0}".format("- *-gene-coverage-annotation-tax.tsv", "- tables with gene coverage, annotation, and taxonomy info\n")) + output.write(" {:<67} {:>0}".format("- *-contig-coverage-and-tax.tsv", "- tables with contig coverage and taxonomy info\n\n")) + + output.write(" {:<71} {:>0}".format("- " + str(mapping_dir), "- per-sample bam, coverage, and mapping info files\n")) + output.write(" {:<67} {:>0}".format("- *.bam", "- bam files\n")) + output.write(" {:<67} {:>0}".format("- *.tsv", "- coverage files used for metabat2 binning\n")) + output.write(" {:<67} {:>0}".format("- *.txt", "- stdout from bowtie2 mapping\n\n")) + + if os.path.exists(bins_dir): + output.write(" {:<71} {:>0}".format("- " + str(bins_dir), "- genomic bins recovered (if any)\n")) + output.write(" {:<67} {:>0}".format("- *.fasta", "- fasta files of bins recovered\n")) + output.write(" {:<67} {:>0}".format(f"- {output_prefix}bins-overview{assay_suffix}.tsv", "- summary stats of bins recovered\n\n")) + + if os.path.exists(MAGs_dir): + output.write(" {:<71} {:>0}".format("- " + str(MAGs_dir), "- high-quality Metagenome-Assembled Genomes recovered (if any; > 90% est. comp., < 10% est. redundancy)\n")) + output.write(" {:<67} {:>0}".format("- *.fasta", "- fasta files of MAGs\n")) + output.write(" {:<67} {:>0}".format(f"- {output_prefix}MAGs-overview{assay_suffix}.tsv", "- summary stats of MAGs including GTDB taxonomy\n")) + output.write(" {:<67} {:>0}".format(f"- {output_prefix}MAG-level-KO-annotations{assay_suffix}.tsv", "- KO functional annotations associated with each MAG\n")) + output.write(" {:<67} {:>0}".format(f"- {output_prefix}MAG-KEGG-Decoder*", "- KEGG-Decoder summaries of MAG functional annotations\n\n")) + + + output.write(" {:<71} {:>0}".format("- " + str(combined_output_dir), "- summary outputs with all samples combined\n")) + output.write(" {:<67} {:>0}".format(f"- {output_prefix}Combined-gene-level-KO-function-coverages{assay_suffix}.tsv", "- table of combined KO function coverages\n")) + output.write(" {:<67} {:>0}".format(f"- {output_prefix}Combined-gene-level-KO-function-coverages-CPM{assay_suffix}.tsv", "- table of combined KO function coverages, normalized to coverage per million\n")) + output.write(" {:<67} {:>0}".format(f"- {output_prefix}Combined-gene-level-taxonomy-coverages{assay_suffix}.tsv", "- table of combined, gene-level taxonomy coverages\n")) + output.write(" {:<67} {:>0}".format(f"- {output_prefix}Combined-gene-level-taxonomy-coverages-CPM{assay_suffix}.tsv", "- table of combined, gene-level taxonomy coverages, normalized to coverage per million\n")) + output.write(" {:<67} {:>0}".format(f"- {output_prefix}Combined-contig-level-taxonomy-coverages{assay_suffix}.tsv", "- table of combined, contig-level taxonomy coverages\n")) + output.write(" {:<67} {:>0}".format(f"- {output_prefix}Combined-contig-level-taxonomy-coverages-CPM{assay_suffix}.tsv", "- table of combined, contig-level taxonomy coverages, normalized to coverage per million\n\n")) + + output.write(" {:<75} {:>0}".format("- " + str(read_based_dir), "- results generated from read-based approach\n")) + output.write(" {:<71} {:>0}".format(f"- {output_prefix}Gene-families{assay_suffix}.tsv", "- gene-family abundances\n")) + output.write(" {:<71} {:>0}".format(f"- {output_prefix}Gene-families-grouped-by-taxa{assay_suffix}.tsv", "- gene-family abundances grouped by taxa\n")) + output.write(" {:<71} {:>0}".format(f"- {output_prefix}Gene-families-cpm{assay_suffix}.tsv", "- gene-family abundances normalized to copies-per-million\n")) + output.write(" {:<71} {:>0}".format(f"- {output_prefix}Gene-families-KO-cpm{assay_suffix}.tsv", "- KO term abundances normalized to copies-per-million\n")) + output.write(" {:<71} {:>0}".format(f"- {output_prefix}Pathway-abundances{assay_suffix}.tsv", "- pathway abundances\n")) + output.write(" {:<71} {:>0}".format(f"- {output_prefix}Pathway-abundances-grouped-by-taxa{assay_suffix}.tsv", "- pathway abundances grouped by taxa\n")) + output.write(" {:<71} {:>0}".format(f"- {output_prefix}Pathway-abundances-cpm{assay_suffix}.tsv", "- pathway abundances normalized to copies-per-million\n")) + output.write(" {:<71} {:>0}".format(f"- {output_prefix}Pathway-coverages{assay_suffix}.tsv", "- pathway coverages\n")) + output.write(" {:<71} {:>0}".format(f"- {output_prefix}Pathway-coverages-grouped-by-taxa{assay_suffix}.tsv", "- pathway coverages grouped by taxa\n")) + output.write(" {:<71} {:>0}".format(f"- {output_prefix}Metaphlan-taxonomy{assay_suffix}.tsv", "- metaphlan estimated taxonomic relative abundances\n\n")) + + # Processing info + output.write(" {:<75} {:>0}".format("- " + str(processing_zip_file), "- zip archive holding info related to processing\n")) + for item in processing_zip_contents: + + num_levels = item.count("/") + + if num_levels > 1 and not item.endswith("/"): + out_item = re.sub(r'^.*/', '', str(item)) + elif num_levels == 1 and not item.endswith("/"): + out_item = re.sub(r'^.*/', '', str(item)) + elif num_levels > 1: + out_item = re.sub(r'^[^/]*/', '', str(item)) + else: + out_item = str(item) + + if item.endswith('/'): + num_levels -= 1 + + num_spaces = num_levels * 4 + + output.write(" " + " " * num_spaces + "- " + out_item + "\n") + + output.write("\n") + + + + +def main(): + ### Variable setup ### + # Suffixes + output_prefix = str(args.output_prefix) + assay_suffix = str(args.assay_suffix) + # Directories + raw_reads_dir = str(args.raw_reads_dir) + fastqc_dir = str(args.fastqc_dir) + filtered_reads_dir = str(args.filtered_reads_dir) + read_based_dir = str(args.read_based_dir) + assembly_based_dir = str(args.assembly_based_dir) + assemblies_dir = str(args.assemblies_dir) + genes_dir = str(args.genes_dir) + annotations_and_tax_dir = str(args.annotations_and_tax_dir) + mapping_dir = str(args.mapping_dir) + bins_dir = str(args.bins_dir) + MAGs_dir = str(args.MAGs_dir) + combined_output_dir = str(args.combined_output_dir) + # Files + processing_zip_file = str(args.processing_zip_file) + output_file = str(args.output) + + processing_zip_contents = get_processing_zip_contents(processing_zip_file) + + with open(output_file, "w") as output: + + write_header(output, args.GLDS_ID, args.name, args.email, args.protocol_ID) + + write_metagenomics_body(output, output_file, assay_suffix, output_prefix, processing_zip_file, + processing_zip_contents, fastqc_dir, raw_reads_dir, filtered_reads_dir, + read_based_dir, assembly_based_dir, assemblies_dir, mapping_dir, genes_dir, + annotations_and_tax_dir, bins_dir, MAGs_dir, combined_output_dir) + + + +if __name__ == "__main__": + main() diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/GL-validate-processed-metagenomics-data b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/GL-validate-processed-metagenomics-data new file mode 100755 index 000000000..d6d40abd6 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/GL-validate-processed-metagenomics-data @@ -0,0 +1,800 @@ +#!/usr/bin/env python + +""" +This is a program for validating GeneLab pipeline processed metagenomics datasets. +""" + +import os +import sys +import argparse +import textwrap +import pandas as pd +import zipfile +from statistics import mean, median + +parser = argparse.ArgumentParser(description = "This program validates a GeneLab pipeline processed metagenomics dataset. It is intended to \ + only be run after `GL-gen-processed-metagenomics-readme` has been run successfully.") +required = parser.add_argument_group('required arguments') + +required.add_argument("-g", "--GLDS-ID", help = 'GLDS ID (e.g. "GLDS-276")', action = "store", required = True) +required.add_argument("-s", "--sample-IDs-file", help = "Single-column file with unique file-name prefixes for each sample", + action = "store", required = True) +parser.add_argument("--output", + help = 'Name of output log file (default: "_metagenomics-validation.log", with appended prefix if one is provided)', + default = "", action = "store") +parser.add_argument("-p", "--output-prefix", help = "Output additional file prefix if there is one", action = "store", default = "") +parser.add_argument("-l", "--V_V_guidelines_link", help = "Validation and verification guidelines link", action = "store", + default = "https://genelab-tools.arc.nasa.gov/confluence/pages/viewpage.action?pageId=8225175") +parser.add_argument("--zip_targets", help = "A comma separated list of target files and/or directories to check in processing_info.zip", + action = "store", default = "Snakefile,config.yaml,envs/,logs/,scripts/,unique-sample-IDs.txt") +parser.add_argument("--assay_suffix", help = "Genelab assay suffix", action = "store", default = "_GLmetagenomics") +parser.add_argument("--raw_suffix", help = "Raw reads suffix", action = "store", default ="_HRremoved_raw.fastq.gz") +parser.add_argument("--raw_R1_suffix", help = "Raw forward reads suffix", action = "store", default = "_R1_HRremoved_raw.fastq.gz") +parser.add_argument("--raw_R2_suffix", help = "Raw reverse reads suffix", action = "store", default = "_R2_HRremoved_raw.fastq.gz") +parser.add_argument("--filtered_suffix", help = "Filtered reads suffix", action = "store", default = "_filtered.fastq.gz") +parser.add_argument("--filtered_R1_suffix", help = "Filtered forward reads suffix", action = "store", default = "_R1_filtered.fastq.gz") +parser.add_argument("--filtered_R2_suffix", help = "Filtered reverse reads suffix", action = "store", default = "_R2_filtered.fastq.gz") +parser.add_argument("--logs_dir_basename", help = "Specifies the basename of the directory containing per sample run logs", + action = "store", default = "logs/") +parser.add_argument("--processing_zip_file", help = "Specifies the location of processing_info.zip", + action = "store", default = "processing_info.zip") +parser.add_argument("--readme", help = "Specifies the location of README.txt", + action = "store", default = "README.txt") +parser.add_argument("--raw_reads_dir", help = "Specifies the location of the raw reads directory if they are to be included", action = "store", default = "") +parser.add_argument("--fastqc_dir", help = "Specifies the location of fastqc and multiqc reports directory", + action = "store", default = "FastQC_Outputs/") +parser.add_argument("--filtered_reads_dir", help = "Specifies the location of the filtered reads directory", + action = "store", default = "Filtered_Sequence_Data/") +parser.add_argument("--assembly_based_dir", help = "Specifies the location of the directory containing results generated from assembly-based processing approach", + action = "store", default = "Assembly-based_Processing/") +parser.add_argument("--read_based_dir", help = "Specifies the location of the directory containing results generated from read-based processing approach", + action = "store", default = "Read-based_Processing/") +parser.add_argument("--assemblies_dir", help = "Specifies the location of the directory containing sample contig assemblies", + action = "store", default = "Assembly-based_Processing/assemblies/") +parser.add_argument("--genes_dir", help = "Specifies the location of the directory containing predicted genes", + action = "store", default = "Assembly-based_Processing/predicted-genes/") +parser.add_argument("--annotations_and_tax_dir", help = "Specifies the location of the directory containing contigs annotation and taxonomy", + action = "store", default = "Assembly-based_Processing/annotations-and-taxonomy/") +parser.add_argument("--mapping_dir", help = "Specifies the location of the directory containing per-sample bam, coverage, and mapping info files", + action = "store", default = "Assembly-based_Processing/read-mapping/") +parser.add_argument("--bins_dir", help = "Specifies the location of the directory containing recovered genome bins", + action = "store", default = "Assembly-based_Processing/bins/") +parser.add_argument("--MAGs_dir", help = "Specifies the location of the directory containing meta-assembled genomes (MAGs)", + action = "store", default = "Assembly-based_Processing/MAGs/") +parser.add_argument("--combined_output_dir", help = "Specifies the location of the directory containing contig annotation summary outputs with all samples combined", + action = "store", default = "Assembly-based_Processing/combined-outputs/") +parser.add_argument("--single-ended", help = "Add this flag if data are single-end sequencing.", action = "store_true") +parser.add_argument("--primers-already-trimmed", help = "Add this flag if primers were trimmed prior to GeneLab processing, \ + therefore there are no trimmed sequence data", action = "store_true") +parser.add_argument("--R1-used-as-single-ended-data", help = "Provide this flag if processing only R1 reads as single-end (as the expected raw \ + filename suffixes will have 'R1' in there)", + action = "store_true") +parser.add_argument("--skip_raw_multiqc", help = "Provide this flag to skip checking for samples present in raw_multiqc_report.zip", + action = "store_true") + + +if len(sys.argv)==1: + parser.print_help(sys.stderr) + sys.exit(0) + +args = parser.parse_args() + + +################################################################################ + +# Setting some colors +tty_colors = { + 'green' : '\033[0;32m%s\033[0m', + 'yellow' : '\033[0;33m%s\033[0m', + 'red' : '\033[0;31m%s\033[0m' +} + + +######################### Aesthetic functions ################################ +def color_text(text, color='green'): + if sys.stdout.isatty(): + return tty_colors[color] % text + else: + return text + + +def wprint(text): + """ Print wrapper """ + print(textwrap.fill(text, width = 80, initial_indent=" ", + subsequent_indent=" ", break_on_hyphens=False)) + + +def report_failure(validation_log, message, color = "yellow", write_log = True): + print("") + wprint(color_text(message, color)) + print("\nValidation failed.\n") + + if write_log: + with open(validation_log, "a") as log: + log.write(message + "\n" + "Validation failed." + "\n\n") + sys.exit(1) + + +def modify_symbolic_link(file_path): + """ Modify symbolic link such that it retruns a string containing the parent dir and the base name""" + full_path = os.path.realpath(file_path) + parent_dir = os.path.basename(os.path.dirname(full_path)) + base_name = os.path.basename(full_path) + mod_path = os.path.join(parent_dir, base_name) + return(mod_path) + + +######################### End of Aesthetic functions ################################ + + +############ Main functions ############## + +def setup_log(validation_log, V_V_guidelines_link): + """ Writes validation log's header """ + + with open(validation_log, "w") as log: + log.write(f"Performing baseline Metagenomics V+V as per: {V_V_guidelines_link}\n\n") + command_run = " ".join(sys.argv) + log.write(f"Validation program executed as:\n {command_run}\n\n") + +def append_message_to_log(validation_log, message, one_return = False): + """ Appends line to validation log with one or two newline characters """ + + with open(validation_log, "a") as log: + if one_return: + log.write(f"{message}\n") + else: + log.write(f"{message}\n\n") + +def check_for_file_and_contents(validation_log, file_path): + """ Used by various functions to check if a file exists and that it is not empty """ + + if not os.path.exists(file_path): + report_failure(validation_log, "The expected file '" + str(file_path) + "' does not exist.") + if not os.path.getsize(file_path) > 0: + report_failure(validation_log, "The file '" + str(file_path) + "' is empty.") + +def check_expected_directories(validation_log, expected_dirs): + """ Checks that the expected directories exist """ + + for directory in expected_dirs: + if not os.path.isdir(directory): + report_failure(validation_log, "The directory '" + str(directory) + "' was expected but not found.") + +def read_samples(file_path): + """ Reads unique sample names from file_path into a list """ + + with open(file_path) as f: + sample_names = f.read().splitlines() + return(sample_names) + +def check_multiqc_outputs(validation_log, sample_names, multiqc_zip, + multiqc_stats_file_path, R1_suffix, + R2_suffix, unpaired_suffix, prefix, isSingle_ended): + """ Makes sure all samples' read files are in the multiqc outputs """ + + # Checking raw + zip_file = zipfile.ZipFile(multiqc_zip) + + df = pd.read_csv(zip_file.open(multiqc_stats_file_path), sep = "\t", usecols = ["Sample"]) + + file_prefixes_in_multiqc = df["Sample"].tolist() + + # If paired-end + if not isSingle_ended: + + R1_suffix = R1_suffix.split(".")[0].replace(f"_{prefix}", "") + R2_suffix = R2_suffix.split(".")[0].replace(f"_{prefix}", "") + + for sample in sample_names: + if not sample + R1_suffix in file_prefixes_in_multiqc: + report_failure(validation_log, f"The {prefix} multiqc output is missing the expected '" + \ + sample + R1_suffix + "' entry.") + if not sample + R2_suffix in file_prefixes_in_multiqc: + report_failure(validation_log, f"The {prefix} multiqc output is missing the expected '" + \ + sample + R2_suffix + "' entry.") + # If single-end + else: + + suffix = unpaired_suffix.split(".")[0].replace(f"_{prefix}", "") + + for sample in sample_names: + if not sample + suffix in file_prefixes_in_multiqc and not sample in file_prefixes_in_multiqc: + report_failure(validation_log, f"The {prefix} multiqc output is missing the expected '" + \ + sample + suffix + "' entry.") + + +def check_fastq_files(validation_log, sample_names, reads_dir, + unpaired_suffix, R1_suffix, R2_suffix, isSingle_ended): + """ Makes sure all expected read fastq files exist and hold something """ + + for sample in sample_names: + ## If paired-end + if not isSingle_ended: + check_for_file_and_contents(validation_log, os.path.join(reads_dir, sample + R1_suffix)) + check_for_file_and_contents(validation_log, os.path.join(reads_dir, sample + R2_suffix)) + ## If single-end + else: + check_for_file_and_contents(validation_log, os.path.join(reads_dir, sample + unpaired_suffix)) + + +def get_files_in_dir(dir_path): + + return([f for f in os.listdir(dir_path) if os.path.isfile(os.path.join(dir_path, f))]) + + +def check_read_based_outputs(validation_log, filenames, read_based_dir): + """ Makes sure outputs exist and aren't empty """ + + for file in filenames: + + check_for_file_and_contents(validation_log, os.path.join(read_based_dir, file)) + + +def check_general_fasta_format(validation_log, file_path): + """ + Check that a fasta file is formatted properly i.e. + the number of headers equals the number of sequences + """ + if not os.path.getsize(file_path) > 0: + report_failure(validation_log, "The fasta file '" + str(file_path) + "' is empty but isn't expected to be.") + + line_num = 0 + num_headers = 0 + num_seqs = 0 + + with open(file_path) as in_file: + + for line in in_file: + + # Keeping track of current line for reporting any problems + line_num += 1 + + if line.strip().startswith(">"): + num_headers += 1 + else: + num_seqs += 1 + + if num_headers != num_seqs + 1 and num_headers != num_seqs: + report_failure(validation_log, "Fasta file '" + str(file_path) + \ + "' does not seem to be formatted properly. Problem detected at line " + \ + str(line_num) + ".") + + +def get_failed_assemblies(failed_assemblies): + """ Retrieves a list of samples for which assembly failed """ + + failed_assemblies_list = [] + + if os.path.exists(failed_assemblies): + with open(failed_assemblies) as failed: + for line in failed: + failed_assemblies_list.append(line.strip().split("\t")[0]) + return(failed_assemblies_list) + + +def check_assembly_based_file(validation_log, sample, file_path, failed_assemblies_list, assembly = True): + + if not os.path.exists(file_path): + report_failure(validation_log, "The expected file '" + str(file_path) + "' does not exist.") + + if not os.path.getsize(file_path) > 0: + + # A sample can have no genes called even if the assembly produced contigs, + # so this is only throwing a warning if we are checking an assembly here + if sample not in failed_assemblies_list and assembly == True: + + report_failure(validation_log, "The file '" + str(file_path) + \ + "' is empty, but that sample isn't noted in the 'Failed-assemblies.tsv' file as it should be if the assembly failed.") + + +def check_assembly_based_genes_file(validation_log, sample, file_path, failed_assemblies_list, assembly = True): + """ + Separate function for working with expected output genes files, to handle + cases where assemblies can succeed while there are still no gene calls + + Just checks the file isn't empty if it exists + """ + + if os.path.exists(file_path) and sample not in failed_assemblies_list: + + if not os.path.getsize(file_path) > 0: + + report_failure(validation_log, "The expected file '" + str(file_path) + \ + "' exists, but appears to be empty when it shouldn't be.") + + +def check_assemblies(validation_log, sample_names, failed_assemblies_list, + assembly_suffix, assemblies_dir, assembly_summary): + """ A function to find sample assemblies """ + + ## Assemblies_dir ## + for sample in sample_names: + + curr_fasta_path = os.path.join(assemblies_dir, sample + assembly_suffix) + + # Checking that the file is present and not empty, unless it is noted + # in the Failed-assemblies file, then continuing to next sample + if sample not in failed_assemblies_list: + + check_assembly_based_file(validation_log, sample, curr_fasta_path, failed_assemblies_list) + + # Checking the general fasta format if present + check_general_fasta_format(validation_log, curr_fasta_path) + + # Making sure assembly summary file is there + assembly_summary_path = os.path.join(assemblies_dir, assembly_summary) + + if not os.path.exists(assembly_summary_path): + report_failure(validation_log, "The assembly summary file, " + str(assembly_summary_path) + \ + ", is expected but was not found.") + + +def check_genes(validation_log, sample_names, failed_assemblies_list, genes_dir, + predicted_gene_file_suffixes, gene_fasta_suffixes): + """ A function to find samples predicted genes associated files """ + + # If any assembly failed, these files won't exist for that assembly + # (they also may not exist if an assembly produced contigs too but not genes were called) + for sample in sample_names: + + if sample not in failed_assemblies_list: + + for suffix in predicted_gene_file_suffixes: + + curr_file_path = os.path.join(genes_dir, sample + suffix) + + # Checking that the file is present and not empty + check_assembly_based_genes_file(validation_log, sample, curr_file_path, + failed_assemblies_list, assembly = False) + + # Checking fasta format for those that exist + for suffix in gene_fasta_suffixes: + + curr_fasta_path = os.path.join(genes_dir, sample + suffix) + + if os.path.exists(curr_fasta_path) and os.path.getsize(curr_fasta_path) > 0: + check_general_fasta_format(validation_log, curr_fasta_path) + + +def check_contig_annotation(validation_log, sample_names, annotations_and_tax_dir, annotations_suffixes): + """Checks that the contig annotation files exist and that they are not empty""" + for sample in sample_names: + + for suffix in annotations_suffixes: + + curr_file_path = os.path.join(annotations_and_tax_dir, sample + suffix) + + check_for_file_and_contents(validation_log, curr_file_path) + + +def check_mapping(validation_log, sample_names, mapping_dir, failed_assemblies_list, + mapping_dir_suffixes_all_have, mapping_info_suffix): + """Checks that the outputs of read mapping to sample assemblies exist and that they are not empty""" + + for sample in sample_names: + + for suffix in mapping_dir_suffixes_all_have: + + curr_file_path = os.path.join(mapping_dir, sample + suffix) + + # Checking the file is present and not empty unless it is noted in the Failed-assemblies file + if sample not in failed_assemblies_list: + check_assembly_based_file(validation_log, sample, curr_file_path, failed_assemblies_list) + + # Checking for mapping-info file for those that should have it + if sample not in failed_assemblies_list: + + curr_file_path = os.path.join(mapping_dir, sample + mapping_info_suffix) + + check_assembly_based_file(validation_log, sample, curr_file_path, failed_assemblies_list) + + +def check_combined_outputs(validation_log, combined_output_dir, expected_assembly_combined_outputs): + """Checks that assembly-based summary files exist and that they are not empty""" + + for filename in expected_assembly_combined_outputs: + + curr_file_path = os.path.join(combined_output_dir, filename) + + check_for_file_and_contents(validation_log, curr_file_path) + + +def check_bins(validation_log, bins_dir, bins_summary, output_fasta_bins): + + # Checking for contents (checking fasta format not straightforward when there are softwraps, + # but don't want to remove them on these due to large contigs) + for bin_file in output_fasta_bins: + + curr_file_path = os.path.join(bins_dir, bin_file) + + if not os.path.getsize(curr_file_path) > 0: + + report_failure(validation_log, "The file '" + str(curr_file_path) + \ + "' is empty, but shouldn't be there if that's the case.") + + # Making sure summary table is there if there are any bins + if len(output_fasta_bins) > 0: + + bins_summary_path = os.path.join(bins_dir, bins_summary) + + if not os.path.exists(bins_summary_path): + + report_failure(validation_log, "The bins summary file, " + str(bins_summary_path) + \ + ", is expected but was not found.") + + +def check_mags(validation_log, MAGs_dir, output_fasta_MAGs, output_fasta_bins, MAGs_summary): + + # Checking for contents (checking fasta format not straightforward when there are softwraps, + # but don't want to remove them on these due to large contigs) + for MAG_file in output_fasta_MAGs: + + curr_file_path = os.path.join(MAGs_dir, MAG_file) + + if not os.path.getsize(curr_file_path) > 0: + + report_failure(validation_log, "The file '" + str(curr_file_path) + \ + "' is empty, but shouldn't be there if that's the case.") + + # Making sure summary table is there if there are any bins + if len(output_fasta_bins) > 0: + + MAGs_summary_path = os.path.join(MAGs_dir, MAGs_summary) + + if not os.path.exists(MAGs_summary_path): + + report_failure(validation_log, "The MAGs summary file, " + str(MAGs_summary_path) + \ + ", is expected but was not found.") + + +def check_assembly_based_overview_table(validation_log, expected_samples, overview_table_path): + """ Makes sure the output table exists and all input samples are in it """ + + # Making sure it exists and is not empty + check_for_file_and_contents(validation_log, overview_table_path) + + # Making sure all samples are in there + # reading in table and getting sample IDs in list + overview_tab = pd.read_csv(overview_table_path, sep = "\t") + samples_in_tab = overview_tab['Sample_ID'].tolist() + + missing_sample_IDs = [] + + for sample in expected_samples: + if sample not in samples_in_tab: + missing_sample_IDs.append(sample) + + if len(missing_sample_IDs) > 0: + report_failure(validation_log, "The assembly overview table, '" + \ + overview_table_path + \ + f"', does not contain these ({', '.join(missing_sample_IDs)}) expected sample(s).") + + +def check_metagenomics_processing_zip(validation_log, samples, processing_zip_file, expected_zip_contents, + expected_log_file_suffixes, logs_dir): + """ This makes sure a processing zip exists and has the expected core components """ + + # Check that the file exists and that it is not empty + check_for_file_and_contents(validation_log, processing_zip_file) + + with zipfile.ZipFile(processing_zip_file) as zip_obj: + entries = zip_obj.namelist() + ROOT_DIR = entries[0] + + for item in expected_zip_contents: + + if ROOT_DIR + item not in entries: + report_failure(validation_log, "The '" + str(processing_zip_file) + \ + "' does not have '" + str(item) + "' as expected.") + + # Checking log files + for sample in samples: + + for suffix in expected_log_file_suffixes: + + target_log = ROOT_DIR + logs_dir + sample + suffix + + if target_log not in entries: + report_failure(validation_log, "The '" + str(processing_zip_file) + \ + "' does not have the '" + str(target_log) + "' log file as expected.") + + +def report_success(validation_log): + print("") + wprint(color_text("Validation has completed successfully :)", "green")) + print(f"\n Log written to: '{validation_log}'\n") + + with open(validation_log, "a") as log: + + log.write(" -----------------------------------------------------------------------------\n") + log.write(" Validation completed successfully." + "\n") + log.write(" -----------------------------------------------------------------------------\n") + +def gen_stats(list_of_ints): + + """ Returns min, max, mean, median of input integer list """ + + min_val = min(list_of_ints) + max_val = max(list_of_ints) + + mean_val = round(mean(list_of_ints), 2) + median_val = int(median(list_of_ints)) + + return(min_val, max_val, mean_val, median_val) + + +def get_read_count_stats(validation_log, prefix, multiqc_zip, multiqc_stats_file_path): + + """ Grabs read counts and summarizes """ + + zip_file = zipfile.ZipFile(multiqc_zip) + + df = pd.read_csv(zip_file.open(multiqc_stats_file_path), sep = "\t", usecols = [6]) + + df.columns = ["counts"] + counts = df.counts.tolist() + + # Getting rid of decimals + counts = [ int(round(i, 0)) for i in counts ] + + Min, Max, Mean, Median = gen_stats(counts) + + + print(f"\n {prefix.title()} read count summary:") + print(" {:<10} {:>0}".format("Min:", Min)) + print(" {:<10} {:>0}".format("Max:", Max)) + print(" {:<10} {:>0}".format("Mean:", Mean)) + print(" {:<10} {:>0}".format("Median:", Median)) + + with open(validation_log, "a") as log: + + log.write(f"\n {prefix.title()} read count summary:") + log.write("\n {:<10} {:>0}".format("Min:", Min)) + log.write("\n {:<10} {:>0}".format("Max:", Max)) + log.write("\n {:<10} {:>0}".format("Mean:", Mean)) + log.write("\n {:<10} {:>0}".format("Median:", Median)) + + +def main(): + + ###---------------------------------------- Variable setup ----------------------------------------------### + output_prefix = str(args.output_prefix) + fastqc_dir = str(args.fastqc_dir) + filtered_reads_dir = str(args.filtered_reads_dir) + read_based_dir = str(args.read_based_dir) + assembly_based_dir = str(args.assembly_based_dir) + assemblies_dir = str(args.assemblies_dir) + genes_dir = str(args.genes_dir) + annotations_and_tax_dir = str(args.annotations_and_tax_dir) + mapping_dir = str(args.mapping_dir) + bins_dir = str(args.bins_dir) + MAGs_dir = str(args.MAGs_dir) + combined_output_dir = str(args.combined_output_dir) + logs_dir = str(args.logs_dir_basename) + processing_zip_file = str(args.processing_zip_file) + + # Just in case user only specified --R1-used-as-single-ended, but didn't specify --single-ended + if args.R1_used_as_single_ended_data: + args.single_ended = True + + V_V_guidelines_link = str(args.V_V_guidelines_link ) + + # Suffixes + assay_suffix = str(args.assay_suffix) + raw_suffix = str(args.raw_suffix) + raw_R1_suffix = str(args.raw_R1_suffix) + raw_R2_suffix = str(args.raw_R2_suffix) + filtered_suffix = str(args.filtered_suffix) + filtered_R1_suffix = str(args.filtered_R1_suffix) + filtered_R2_suffix = str(args.filtered_R2_suffix) + assembly_suffix = "-assembly.fasta" + predicted_gene_file_suffixes = ["-genes.faa", "-genes.gff", "-genes.fasta"] + gene_fasta_suffixes = ["-genes.faa", "-genes.fasta"] + annotations_suffixes = ["-gene-coverage-annotation-and-tax.tsv", "-contig-coverage-and-tax.tsv"] + mapping_dir_suffixes_all_have = [".bam", "-metabat-assembly-depth.tsv"] + mapping_info_suffix = "-mapping-info.txt" + + # Expected Directories + expected_dirs = [fastqc_dir, filtered_reads_dir, assembly_based_dir, + assemblies_dir, genes_dir, annotations_and_tax_dir, mapping_dir, + combined_output_dir, bins_dir, MAGs_dir, read_based_dir] + + if args.raw_reads_dir != "": + expected_dirs.append(args.raw_reads_dir) + + + # Expected files + assembly_summary = f"{output_prefix}assembly-summaries{assay_suffix}.tsv" + failed_assemblies = os.path.join(assemblies_dir,f"{output_prefix}Failed-assemblies.tsv") + + raw_multiqc_zip = f"{output_prefix}raw_multiqc{assay_suffix}_report.zip" + filtered_multiqc_zip = f"{output_prefix}filtered_multiqc{assay_suffix}_report.zip" + raw_multiqc_stats_file_path = f"{output_prefix}raw_multiqc_report.zip".split(".")[0] + \ + f"/{output_prefix}raw_multiqc_data/multiqc_general_stats.txt" + filtered_multiqc_stats_file_path = f"{output_prefix}filtered_multiqc_report.zip".split(".")[0] + \ + f"/{output_prefix}filtered_multiqc_data/multiqc_general_stats.txt" + + + expected_assembly_combined_outputs = [f"{output_prefix}Combined-contig-level-taxonomy-coverages-CPM{assay_suffix}.tsv", + f"{output_prefix}Combined-gene-level-KO-function-coverages-CPM{assay_suffix}.tsv", + f"{output_prefix}Combined-gene-level-taxonomy-coverages-CPM{assay_suffix}.tsv", + f"{output_prefix}Combined-contig-level-taxonomy-coverages{assay_suffix}.tsv", + f"{output_prefix}Combined-gene-level-KO-function-coverages{assay_suffix}.tsv", + f"{output_prefix}Combined-gene-level-taxonomy-coverages{assay_suffix}.tsv"] + + assembly_based_overview_table = os.path.join(assembly_based_dir, f"{output_prefix}Assembly-based-processing-overview{assay_suffix}.tsv") + + expected_read_based_outputs = [f"{output_prefix}Gene-families-KO-cpm{assay_suffix}.tsv", + f"{output_prefix}Gene-families-cpm{assay_suffix}.tsv", + f"{output_prefix}Gene-families-grouped-by-taxa{assay_suffix}.tsv", + f"{output_prefix}Gene-families{assay_suffix}.tsv", + f"{output_prefix}Metaphlan-taxonomy{assay_suffix}.tsv", + f"{output_prefix}Pathway-abundances-cpm{assay_suffix}.tsv", + f"{output_prefix}Pathway-abundances-grouped-by-taxa{assay_suffix}.tsv", + f"{output_prefix}Pathway-abundances{assay_suffix}.tsv", + f"{output_prefix}Pathway-coverages-grouped-by-taxa{assay_suffix}.tsv", + f"{output_prefix}Pathway-coverages{assay_suffix}.tsv"] + + expected_zip_contents = str(args.zip_targets).split(",") + + #expected_log_file_suffixes = ["-CAT.log", "-assembly.log", "-bam-summarize-and-metabat.log", "-bowtie2-build.log", + # "-bbduk.log", "-kofamscan.log", "-pileup.log", "-prodigal.log", "-humann3-run.log"] + + expected_log_file_suffixes = ["-assembly.log", "-bbduk.log"] + + # Setting-up the output log file name + if args.output == "": + validation_log = f"{str(args.GLDS_ID)}_{output_prefix}metagenomics-validation.log" + else: + validation_log = str(args.output) + + # ------------------------------------------------- Logging Begins -----------------------------------------------------------# + + # Initializing the log file + setup_log(validation_log, V_V_guidelines_link) + append_message_to_log(validation_log, f"Summary of checks:") + + # Check if README.txt exists + check_for_file_and_contents(validation_log, args.readme) + append_message_to_log(validation_log, f" - populated {args.readme} detected") + # Check if the expected directories exist + check_expected_directories(validation_log, expected_dirs) + # Retrieve unique sample names from the sample IDs file + sample_names = read_samples(args.sample_IDs_file) + + # Check raw multiqc outputs + raw_multiqc_zip = os.path.join(fastqc_dir, raw_multiqc_zip) + raw_prefix = "raw" + + if not args.skip_raw_multiqc: + check_multiqc_outputs(validation_log, sample_names, raw_multiqc_zip, + raw_multiqc_stats_file_path, raw_R1_suffix, + raw_R2_suffix, raw_suffix, raw_prefix, args.single_ended) + append_message_to_log(validation_log, f" - all expected samples were found in raw multiqc files in {fastqc_dir}") + + # Check filtered multiqc outputs + filtered_multiqc_zip = os.path.join(fastqc_dir,filtered_multiqc_zip) + filtered_prefix = "filtered" + check_multiqc_outputs(validation_log, sample_names, filtered_multiqc_zip, + filtered_multiqc_stats_file_path, filtered_R1_suffix, + filtered_R2_suffix, filtered_suffix, filtered_prefix, args.single_ended) + append_message_to_log(validation_log, f" - all expected samples were found in filtered multiqc files in {fastqc_dir}") + + # Raw reads + if args.raw_reads_dir != "": + check_fastq_files(validation_log, sample_names, args.raw_reads_dir, + raw_suffix, raw_R1_suffix, raw_R2_suffix, args.single_ended) + append_message_to_log(validation_log, f" - all expected fastq read files were found in {args.raw_reads_dir}") + + # Filtered reads + check_fastq_files(validation_log, sample_names, filtered_reads_dir, + filtered_suffix, filtered_R1_suffix, + filtered_R2_suffix, args.single_ended) + append_message_to_log(validation_log, f" - all expected fastq read files were found in {filtered_reads_dir}") + + # -------- Read-based approach files checking --------# + check_read_based_outputs(validation_log, expected_read_based_outputs, read_based_dir) + for file in expected_read_based_outputs: + append_message_to_log(validation_log, f" - {file} was found in {read_based_dir}") + append_message_to_log(validation_log, f" - all expected files for read-based analysis were found in the {read_based_dir} directory") + + # ------------- Aseembly-based approach files checking ---------# + # Get list of samples for which assembly failed + failed_assemblies_list = get_failed_assemblies(failed_assemblies) + + # Check assemblies + check_assemblies(validation_log, sample_names, failed_assemblies_list, + assembly_suffix, assemblies_dir, assembly_summary) + mod_assemblies_dir = modify_symbolic_link(assemblies_dir) if os.path.islink(assemblies_dir) else assemblies_dir + if len(failed_assemblies_list) > 0: + append_message_to_log(validation_log, f" - all samples except {', '.join(failed_assemblies_list)} had assemblies found in {mod_assemblies_dir}") + else: + append_message_to_log(validation_log, f" - all samples had assemblies found in {mod_assemblies_dir}") + append_message_to_log(validation_log, f" - {assembly_summary} was found in {mod_assemblies_dir}") + append_message_to_log(validation_log, f" - all expected assembly files for assembly-based analysis were found in the {mod_assemblies_dir} directory") + + # Check genes + check_genes(validation_log, sample_names, failed_assemblies_list, + genes_dir, predicted_gene_file_suffixes, gene_fasta_suffixes) + mod_genes_dir = modify_symbolic_link(genes_dir) if os.path.islink(genes_dir) else genes_dir + + checked_suffixes = predicted_gene_file_suffixes + gene_fasta_suffixes + for suffix in checked_suffixes: + append_message_to_log(validation_log, f" - *{suffix} predicted genes files were found in {mod_genes_dir}") + append_message_to_log(validation_log, f" - all expected predicted genes files for assembly-based analysis were found in the {mod_genes_dir} directory") + + # Check contig annotation + check_contig_annotation(validation_log, sample_names, annotations_and_tax_dir, annotations_suffixes) + mod_annotations_and_tax_dir = modify_symbolic_link(annotations_and_tax_dir) if os.path.islink(annotations_and_tax_dir) else annotations_and_tax_dir + + for suffix in annotations_suffixes: + append_message_to_log(validation_log, f" - *{suffix} annotation files were found in {mod_annotations_and_tax_dir}") + append_message_to_log(validation_log, f" - all expected annotation files for assembly-based analysis were found in the {mod_annotations_and_tax_dir} directory") + + # Check read mapping + check_mapping(validation_log, sample_names, mapping_dir, failed_assemblies_list, + mapping_dir_suffixes_all_have, mapping_info_suffix) + mod_mapping_dir = modify_symbolic_link(mapping_dir) if os.path.islink(mapping_dir) else mapping_dir + checked_suffixes = mapping_dir_suffixes_all_have + [mapping_info_suffix] + for suffix in checked_suffixes: + append_message_to_log(validation_log, f" - *{suffix} read mapping files were found in the {mod_mapping_dir}") + append_message_to_log(validation_log, f" - all expected read mapping files for assembly-based analysis were found in the {mod_mapping_dir} directory") + + # Combined contigs annotation outputs + check_combined_outputs(validation_log, combined_output_dir, expected_assembly_combined_outputs) + mod_combined_output_dir = modify_symbolic_link(combined_output_dir) if os.path.islink(combined_output_dir) else combined_output_dir + for file in expected_assembly_combined_outputs: + append_message_to_log(validation_log, f" - {file} was found in {mod_combined_output_dir}") + append_message_to_log(validation_log, f" - all expected contig annotation summary files for assembly-based analysis were found in the {mod_combined_output_dir} directory") + + # Check bins - Only if there were bins recovered + output_files_present = get_files_in_dir(bins_dir) + if output_files_present: + bins_summary = f"{output_prefix}bins-overview{assay_suffix}.tsv" + output_fasta_bins = [filename for filename in output_files_present if filename.endswith(".fasta")] + check_bins(validation_log, bins_dir, bins_summary, output_fasta_bins) + mod_bins_dir = modify_symbolic_link(bins_dir) if os.path.islink(bins_dir) else bins_dir + append_message_to_log(validation_log, f" - bins were found in {mod_bins_dir}") + append_message_to_log(validation_log, f" - {bins_summary} was found in {mod_bins_dir}") + else: + append_message_to_log(validation_log, f" - No bin was recovered for any sample") + + # Check MAGS - only if there were MAGs recovered + output_files_present = get_files_in_dir(MAGs_dir) + if output_files_present: + output_fasta_MAGs = [filename for filename in output_files_present if filename.endswith(".fasta")] + MAGs_summary = f"{output_prefix}MAGs-overview{assay_suffix}.tsv" + check_mags(validation_log, MAGs_dir, output_fasta_MAGs, output_fasta_bins, MAGs_summary) + mod_MAGs_dir = modify_symbolic_link(MAGs_dir) if os.path.islink(MAGs_dir) else MAGs_dir + append_message_to_log(validation_log, f" - MAGs were found in {mod_MAGs_dir}") + append_message_to_log(validation_log, f" - {MAGs_summary} was found in {mod_MAGs_dir} directory") + else: + append_message_to_log(validation_log, f" - No MAG was recovered for any sample") + + check_assembly_based_overview_table(validation_log, sample_names, assembly_based_overview_table) + append_message_to_log(validation_log, f" - {assembly_based_overview_table} was found in {assembly_based_dir}") + + append_message_to_log(validation_log, f" - all expected files were found in the {assembly_based_dir} directory") + + # Check processing info + check_metagenomics_processing_zip(validation_log, sample_names, processing_zip_file, + expected_zip_contents, expected_log_file_suffixes, logs_dir) + for file in expected_zip_contents: + append_message_to_log(validation_log, f" - {file} was found in {processing_zip_file}") + + suffixes_modified = [f"*{suffix}" for suffix in expected_log_file_suffixes] + files = ", ".join(suffixes_modified) + append_message_to_log(validation_log, + f" - all expected sample log files with these suffixes ({files}) were found in {processing_zip_file}") + append_message_to_log(validation_log, f" - all expected files were found in {processing_zip_file}") + + # ------------- Summarize ------------------------# + report_success(validation_log) + # Raw + get_read_count_stats(validation_log, raw_prefix, raw_multiqc_zip, raw_multiqc_stats_file_path) + # Filtered + get_read_count_stats(validation_log, filtered_prefix, filtered_multiqc_zip, filtered_multiqc_stats_file_path) + +if __name__ == "__main__": + main() diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/clean-paths.sh b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/clean-paths.sh new file mode 100644 index 000000000..bdbc4b4fa --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/clean-paths.sh @@ -0,0 +1,37 @@ +#!/usr/bin/env bash +set -e + +# only built for use on N288 cluster + +# example usage: bash clean-paths.sh + +# making sure by chance we are not overwriting a wanted file called 't' + +if [ -s t ]; then + printf "\n This simple program temporarily writes to a file called 't'\n" + printf " Since that exists already here, we are not going to continue.\n\n" + exit +fi + +FILE=$1 +ROOT_DIR=$(echo $2 | awk '{N=split($0,a,"/"); for(i=0; i < N-1; i++) printf "%s/", a[i]}' | sed 's|//|/|') + + +# Remove path in paired end runsheet +if [ `awk 'NR==1{print}' ${FILE} | grep -c reverse` -gt 0 ]; then + + awk 'BEGIN{FS=OFS=","} NR==1{print} NR>1{split($2, f, "/");split($3, r, "/"); print $1,f[length(f)],r[length(r)],$4}' ${FILE} > temp && mv temp ${FILE} + +# Remove path in single end runsheet +elif [ `awk 'NR==1{print}' ${FILE} | grep -c forward` -gt 0 ]; then + + + awk 'BEGIN{FS=OFS=","} NR==1{print} NR>1{split($2, f, "/"); print $1,f[length(f)],$3}' ${FILE} > temp && mv temp ${FILE} + +fi + +sed -E 's|.*/GLDS_Datasets/(.+)|\1|g' ${FILE} \ + | sed -E 's|.+/miniconda.+/envs/[^/]*/||g' \ + | sed -E 's|/[^ ]*/GLDS-|GLDS-|g' \ + | sed -E 's|/[a-z]{6}/[^ ]*||g' \ + | sed -E "s|${ROOT_DIR}||g" > t && mv t ${FILE} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/combine-all-gene-tables.py b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/combine-all-gene-tables.py new file mode 100644 index 000000000..01f44186f --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/combine-all-gene-tables.py @@ -0,0 +1,312 @@ +#!/usr/bin/env python + +""" +This is an ad hoc script for the corresponding workflow. It combines and summarizes all the group sample gene-level coverages by KO annotations (1 table) and taxonomy (another table), +including not annotated and not classified, and also produces CPM (coverage-per-million) normalized versions. + +Modified from my `bit-GL-combine-KO-and-tax-tables`: https://github.com/AstrobioMike/bioinf_tools +""" + +import os +import sys +import argparse +import textwrap +import pandas as pd +from math import isnan +from numpy import NaN + +parser = argparse.ArgumentParser(description="This is an ad hoc script for the corresponding workflow. It combines and summarizes \ + all the group sample gene-level coverages by KO annotations (1 table) and taxonomy (another table),\ + including not annotated and not classified, and also produces CPM (coverage-per-million) normalized versions.") + +required = parser.add_argument_group('required arguments') + +required.add_argument("input_tables", metavar="input-tables", type=str, nargs="+", help="Input coverage, annotation, and tax tables (as written, expected to end with extension '.tsv'.") +parser.add_argument("-o", "--output-dir", help='Desired output directory (default: "./")', action="store", default="./", dest="output_dir") + +if len(sys.argv)==1: + parser.print_help(sys.stderr) + sys.exit(0) + +args = parser.parse_args() + +################################################################################ + + +def main(): + + check_all_inputs_exist(args.input_tables) + + input_files, group_names = setup_input_lists(args.input_tables) + + KO_dict, tax_dict = {}, {} + + na_taxids = [] + + KO_collapsed_tabs, tax_collapsed_tabs, KO_dict, tax_dict = process_each_table(input_files, KO_dict, tax_dict, na_taxids) + + combined_KO_tab, combined_norm_KO_tab, combined_tax_tab, combined_norm_tax_tab = combine_tabs(KO_collapsed_tabs, tax_collapsed_tabs, KO_dict, tax_dict) + + # writing out tables + combined_KO_tab.to_csv(args.output_dir + "All-combined-KO-function-coverages.tsv", index=False, sep="\t") + combined_norm_KO_tab.to_csv(args.output_dir + "All-combined-KO-function-CPM-normalized-coverages.tsv", index=False, sep="\t") + + combined_tax_tab.to_csv(args.output_dir + "All-combined-taxonomy-coverages.tsv", index=False, sep="\t") + combined_norm_tax_tab.to_csv(args.output_dir + "All-combined-taxonomy-CPM-normalized-coverages.tsv", index=False, sep="\t") + + +################################################################################ + + +# setting some colors +tty_colors = { + 'green' : '\033[0;32m%s\033[0m', + 'yellow' : '\033[0;33m%s\033[0m', + 'red' : '\033[0;31m%s\033[0m' +} + + +### functions ### +def color_text(text, color='green'): + if sys.stdout.isatty(): + return tty_colors[color] % text + else: + return text + + +def wprint(text): + """ print wrapper """ + + print(textwrap.fill(text, width=80, initial_indent=" ", + subsequent_indent=" ", break_on_hyphens=False)) + + +def check_all_inputs_exist(input_tables): + + for file in input_tables: + if not os.path.exists(file): + print("") + wprint(color_text("It seems the specified input file '" + str(file) + "' can't be found.", "yellow")) + print("\nExiting for now.\n") + sys.exit(1) + + +def setup_input_lists(input_tables): + """ setting up input lists for file locations and sample names """ + + input_files = [] + group_names = [] + + for group in input_tables: + input_files.append(group) + group_names.append(os.path.splitext(os.path.basename(group))[0].replace("-gene-coverages-annotations-and-tax", "")) + + return(input_files, group_names) + + +def add_to_KO_dict(table, KO_dict): + """ function for building KO mapping dictionary """ + + for index, row in table.iterrows(): + + if str(row["KO_ID"]).startswith("K"): + + if str(row["KO_ID"]) not in KO_dict: + + KO_dict[row["KO_ID"]] = row["KO_function"] + + return(KO_dict) + + +def add_to_tax_dict(table, tax_dict, na_taxids): + """ function for building tax mapping dictionary """ + + for index, row in table.iterrows(): + + # skipping if not classified + if not pd.isna(row["taxid"]): + + if not row["taxid"] in tax_dict: + tax_dict[row["taxid"]] = row[["domain", "phylum", "class", "order", "family", "genus", "species"]].tolist() + + # some taxids have all NA for these ranks (like 1 and 131567), keep track so can sum with not classified + if len(set(row[["domain", "phylum", "class", "order", "family", "genus", "species"]].tolist())) == 1: + na_taxids.append(row["taxid"]) + + + return(tax_dict, na_taxids) + + +def get_na_taxids(tax_dict): + """ some taxids have all NA for these ranks (like 1 and 131567), keeping track of those so can sum together with the "Not classified" row """ + + na_taxids = [] + + for key in tax_dict: + if len(set(mock_dict[key])) == 1: + na_taxids.append(key) + + return(na_taxids) + + +def process_each_table(input_files, KO_dict, tax_dict, na_taxids): + """ reads in each table, normalizes coverage values, collapses based on KO annotations """ + + KO_collapsed_tabs = [] + tax_collapsed_tabs = [] + + for i in range(len(input_files)): + + tab = pd.read_csv(input_files[i], sep="\t", dtype = {'taxid': str}) + + # getting sample column names + sample_cols = tab.columns[11:].tolist() + + # building dictionaries that will hold all KO terms and taxa from all input files + KO_dict = add_to_KO_dict(tab, KO_dict) + tax_dict, na_taxids = add_to_tax_dict(tab, tax_dict, na_taxids) + + # making collapsed KO and tax tables + KO_tab = tab[['KO_ID'] + sample_cols].copy() + # collapsing based on KO terms + KO_tab = KO_tab.groupby(by = ['KO_ID'], dropna = False).sum() + + tax_tab = tab[['taxid'] + sample_cols].copy() + # setting any taxids that are all NA at these standard ranks to "NA" (some have an assigned taxid, but don't have a D/P/C/O/F/G/S taxid, like 1 and 131567) + tax_tab.replace(na_taxids, NaN, inplace = True) + # collapsing based on tax + tax_tab = tax_tab.groupby(by = ['taxid'], dropna = False).sum() + + # appending to lists of tables + KO_collapsed_tabs.append(KO_tab) + tax_collapsed_tabs.append(tax_tab) + + return(KO_collapsed_tabs, tax_collapsed_tabs, KO_dict, tax_dict) + + +def add_KO_functions(tab, KO_dict): + """ adds KO functions to combined table based on KO_ID and KO_dict object holding mappings """ + + KO_functions = [] + + for KO in tab.KO_ID: + + if KO in KO_dict: + + KO_functions.append(str(KO_dict[KO])) + + else: + + KO_functions.append("Not annotated") + + tab.insert(1, "KO_function", KO_functions) + + return(tab) + +def add_tax_info(tab, tax_dict): + """ adds lineage info back to combined table based on taxid and tax_dict object holding mappings """ + + domain_list, phylum_list, class_list, order_list, family_list, genus_list, species_list = [], [], [], [], [], [], [] + + for taxid in tab.taxid: + + if taxid in tax_dict: + + if isinstance(tax_dict[taxid][0], str): + domain_list.append(tax_dict[taxid][0]) + else: + domain_list.append("NA") + + if isinstance(tax_dict[taxid][1], str): + phylum_list.append(tax_dict[taxid][1]) + else: + phylum_list.append("NA") + + if isinstance(tax_dict[taxid][2], str): + class_list.append(tax_dict[taxid][2]) + else: + class_list.append("NA") + + if isinstance(tax_dict[taxid][3], str): + order_list.append(tax_dict[taxid][3]) + else: + order_list.append("NA") + + if isinstance(tax_dict[taxid][4], str): + family_list.append(tax_dict[taxid][4]) + else: + family_list.append("NA") + + if isinstance(tax_dict[taxid][5], str): + genus_list.append(tax_dict[taxid][5]) + else: + genus_list.append("NA") + + + if isinstance(tax_dict[taxid][6], str): + species_list.append(tax_dict[taxid][6]) + else: + species_list.append("NA") + + else: + domain_list.append("NA") + phylum_list.append("NA") + class_list.append("NA") + order_list.append("NA") + family_list.append("NA") + genus_list.append("NA") + species_list.append("NA") + + tab.insert(1, "domain", domain_list) + tab.insert(2, "phylum", phylum_list) + tab.insert(3, "class", class_list) + tab.insert(4, "order", order_list) + tab.insert(5, "family", family_list) + tab.insert(6, "genus", genus_list) + tab.insert(7, "species", species_list) + + return(tab) + + +def combine_tabs(KO_tab_list, tax_tab_list, KO_dict, tax_dict): + """ combines all KO tables into one and all tax tables into one """ + + # combining KO tabs + KO_combined_tab = pd.concat(KO_tab_list, axis=1).drop_duplicates().fillna(0).sort_index() + + # moving index to be column and changing that NaN to be "Not annotated", and naming column back to KO_ID + KO_combined_tab = KO_combined_tab.reset_index().fillna("Not annotated") + KO_combined_tab.rename(columns = {"index":'KO_ID'}, inplace = True) + + # adding KO functions + KO_combined_tab = add_KO_functions(KO_combined_tab, KO_dict) + + # combining tax tabs + tax_combined_tab = pd.concat(tax_tab_list, axis=1).drop_duplicates().fillna(0).sort_index() + + # moving index to be column and naming column back to taxid + tax_combined_tab = tax_combined_tab.reset_index() + + # changing the NaN to be "Not annotated" and naming column back to taxid + tax_combined_tab['index'] = tax_combined_tab['index'].fillna("Not classified") + tax_combined_tab.rename(columns = {"index":'taxid'}, inplace = True) + + # adding tax full lineage info + tax_combined_tab = add_tax_info(tax_combined_tab, tax_dict) + + # making CPM-normalized versions of each + KO_combined_norm_tab = KO_combined_tab.copy() + tax_combined_norm_tab = tax_combined_tab.copy() + + # getting sample column names + sample_cols = KO_combined_norm_tab.columns[2:].tolist() + + # making normalized versions + for col in sample_cols: + KO_combined_norm_tab[col] = KO_combined_norm_tab[col] / KO_combined_norm_tab[col].sum() * 1000000 + tax_combined_norm_tab[col] = tax_combined_norm_tab[col] / tax_combined_norm_tab[col].sum() * 1000000 + + return(KO_combined_tab, KO_combined_norm_tab, tax_combined_tab, tax_combined_norm_tab) + +if __name__ == "__main__": + main() diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/combine-gene-level-coverages-annots-and-tax-per-group.py b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/combine-gene-level-coverages-annots-and-tax-per-group.py new file mode 100644 index 000000000..f6737c0f2 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/combine-gene-level-coverages-annots-and-tax-per-group.py @@ -0,0 +1,151 @@ +#!/usr/bin/env python + +""" +This is an ad hoc script for the corresponding workflow. It combines the sample gene-level coverage files, taxonomy, and KO annotations into one table for each group of samples. +It produces 2 output files, one normalized to coverage-per-million, one not normalized. + +Modified from my `bit-GL-combine-KO-and-tax-tables`: https://github.com/AstrobioMike/bioinf_tools +""" + +import os +import sys +import argparse +import textwrap +import pandas as pd +from math import isnan +from numpy import NaN + +parser = argparse.ArgumentParser(description="This is an ad hoc script for the corresponding workflow. It combines the individual sample gene-level coverage files and KO annotations into one table. \ + It produces 2 output files, one normalized to coverage-per-million, one not normalized.") + +required = parser.add_argument_group('required arguments') + + +required.add_argument("input_coverage_tables", metavar="input-coverage-tables", type=str, nargs="+", help="Input gene-level coverage tables (as written, expected to end with extension '.tsv'.") +required.add_argument("-a", "--KO-annotations-file", help="Input KO annotation table", action="store", dest="KO_tab") +required.add_argument("-t", "--taxonomy-file", help="Input taxonomy table", action="store", dest="tax_tab") +required.add_argument("-g", "--group-ID", help="Group ID", action="store", dest="group") +parser.add_argument("-o", "--output-dir", help="Output directory", action="store", dest="output_dir", default="./") + +if len(sys.argv)==1: + parser.print_help(sys.stderr) + sys.exit(0) + +args = parser.parse_args() + +################################################################################ + + +def main(): + + check_all_inputs_exist(args.input_coverage_tables, args.KO_tab, args.tax_tab) + + input_files, sample_names = setup_input_lists(args.input_coverage_tables, args.group) + + building_df = combine_KO_and_tax_tab(args.KO_tab, args.tax_tab) + + unnormd_combined_tab, normd_combined_tab = process_and_combine_each_coverage_table(input_files, sample_names) + + unnormd_final_tab, normd_final_tab = combine_all(building_df, unnormd_combined_tab, normd_combined_tab) + + # writing out + unnormd_final_tab.to_csv(args.output_dir + args.group + "-gene-coverages-annotations-and-tax.tsv", index=False, sep="\t", na_rep = "NA") + normd_final_tab.to_csv(args.output_dir + args.group + "-CPM-normalized-gene-coverages-annotations-and-tax.tsv", index=False, sep="\t", na_rep = "NA") + + +################################################################################ + + +# setting some colors +tty_colors = { + 'green' : '\033[0;32m%s\033[0m', + 'yellow' : '\033[0;33m%s\033[0m', + 'red' : '\033[0;31m%s\033[0m' +} + + +### functions ### +def color_text(text, color='green'): + if sys.stdout.isatty(): + return tty_colors[color] % text + else: + return text + + +def wprint(text): + """ print wrapper """ + + print(textwrap.fill(text, width=80, initial_indent=" ", + subsequent_indent=" ", break_on_hyphens=False)) + + +def check_all_inputs_exist(input_tables, KO_tab, tax_tab): + + for file in input_tables + [KO_tab] + [tax_tab]: + if not os.path.exists(file): + print("") + wprint(color_text("It seems the specified input file '" + str(file) + "' can't be found.", "yellow")) + print("\nExiting for now.\n") + sys.exit(1) + + +def setup_input_lists(input_tables, group): + """ setting up input lists for file locations and sample names """ + + input_files = [] + sample_names = [] + + for sample in input_tables: + input_files.append(sample) + sample_names.append(os.path.splitext(os.path.basename(sample))[0].replace("-" + group + "-gene-coverages", "")) + + return(input_files, sample_names) + + +def combine_KO_and_tax_tab(KO_tab, tax_tab): + + KO_df = pd.read_csv(KO_tab, sep="\t") + tax_df = pd.read_csv(tax_tab, sep="\t", dtype = {"taxid": pd.Int64Dtype()}) # this is needed to keep the taxids without a decimal while handling those that are NA + combined_df = pd.merge(KO_df, tax_df) + return(combined_df) + +def process_and_combine_each_coverage_table(input_files, sample_names): + """ reads in each table, creates combined tables, one normalized to coverage-per-million, one not normalized """ + + normd_tabs = [] + unnormd_tabs = [] + + # iterator to access the same input file and sample name + for i in range(len(input_files)): + + unnormd_tab = pd.read_csv(input_files[i], sep="\t") + + # generating a normalized version + normd_tab = unnormd_tab.copy() + normd_tab.coverage = normd_tab.coverage / normd_tab.coverage.sum() * 1000000 + + # changing coverage column headers to be sample name + unnormd_tab.rename(columns = {"coverage":sample_names[i]}, inplace = True) + normd_tab.rename(columns = {"coverage":sample_names[i]}, inplace = True) + + # adding to lists + unnormd_tabs.append(unnormd_tab) + normd_tabs.append(normd_tab) + + + # combining tables + unnormd_combined_tab = pd.concat(unnormd_tabs, axis = 1).T.drop_duplicates().T + normd_combined_tab = pd.concat(normd_tabs, axis = 1).T.drop_duplicates().T + + return(unnormd_combined_tab, normd_combined_tab) + +def combine_all(building_df, unnormd_combined_tab, normd_combined_tab): + """ combines KO annotations and tax with coverage tables """ + + final_unnormd_tab = pd.merge(building_df, unnormd_combined_tab) + final_normd_tab = pd.merge(building_df, normd_combined_tab) + + return(final_unnormd_tab, final_normd_tab) + +if __name__ == "__main__": + main() diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/create_runsheet.sh b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/create_runsheet.sh new file mode 100644 index 000000000..dc66a1e3d --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/create_runsheet.sh @@ -0,0 +1,15 @@ +#!/usr/bin/env bash + +# A script to the the input csv file rtequired by this pipeline when a GLDS accession is provided +# Rather than the required input csv file + +ASSAY_TABLE=$1 # a_GLDS-466_metagenome-sequencing_whole-genome-shotgun-sequencing_illumina.txt +awk -v PWD=$PWD -F "\t" ' + BEGIN{print "sample_id,forward,reverse,paired"} \ + NR==1{for (i=1; i<=NF; i++) {ix[$i] = i}} \ + NR>1{gsub(" ", "", $ix["Raw Data File"]); \ + split($ix["Raw Data File"], reads_path, ","); \ + gsub("PAIRED","true",$ix["Parameter Value[Library Layout]"]); \ + gsub("SINGLE","false",$ix["Parameter Value[Library Layout]"]); \ + printf "%s,%s/Raw_Sequence_Data/%s,%s/Raw_Sequence_Data/%s,%s\n",$ix["Sample Name"], PWD, reads_path[1], PWD,reads_path[2],$ix["Parameter Value[Library Layout]"]} + ' ${ASSAY_TABLE} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/download-GTDBTK-db.sh b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/download-GTDBTK-db.sh new file mode 100644 index 000000000..60186c16f --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/download-GTDBTK-db.sh @@ -0,0 +1,27 @@ +#!/usr/bin/env bash + +set -e + +echo "Downloading the GTDB-Tk database to ${GTDBTK_DATA_PATH}..." + +# GTDBTK_DB_PATH is defined in build.sh, store the db there + + +DB_URL=$1 +TAR_FILE=$(basename ${DB_URL}) + + +downloadFile=true + +while ${downloadFile};do + + wget --timeout=3600 --tries=0 --continue ${DB_URL} -P ${GTDBTK_DATA_PATH} && downloadFile=false + +done + +tar xvzf ${GTDBTK_DATA_PATH}/${TAR_FILE} -C ${GTDBTK_DATA_PATH} --strip 1 +rm ${GTDBTK_DATA_PATH}/${TAR_FILE} + +echo "GTDB-Tk database has been successfully downloaded." + +exit 0 diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/format-contig-tax-classifications.sh b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/format-contig-tax-classifications.sh new file mode 100644 index 000000000..984b427d0 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/format-contig-tax-classifications.sh @@ -0,0 +1,6 @@ +#!/usr/bin/env bash + +awk -F $'\t' ' BEGIN { OFS = FS } { if ( $2 == "classification" ) { print $1,$4,$6,$7,$8,$9,$10,$11,$12 } \ + else if ( $2 == "no taxid assigned" ) { print $1,"NA","NA","NA","NA","NA","NA","NA","NA" } \ + else { n=split($4,lineage,";"); print $1,lineage[n],$6,$7,$8,$9,$10,$11,$12 } } ' ${1} \ + | sed 's/no support/NA/g' | sed 's/superkingdom/domain/' | sed 's/^# contig/contig_ID/' | sed 's/lineage/taxid/' > ${2} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/format-gene-tax-classifications.sh b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/format-gene-tax-classifications.sh new file mode 100644 index 000000000..7e7e9dff3 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/format-gene-tax-classifications.sh @@ -0,0 +1,6 @@ +#!/usr/bin/env bash + + awk -F $'\t' ' BEGIN { OFS = FS } { if ( $3 == "lineage" ) { print $1,$3,$5,$6,$7,$8,$9,$10,$11 } \ + else if ( $2 == "ORF has no hit to database" || $2 ~ /^no taxid found/ ) { print $1,"NA","NA","NA","NA","NA","NA","NA","NA" } \ + else { n=split($3,lineage,";"); print $1,lineage[n],$5,$6,$7,$8,$9,$10,$11 } } ' ${1} \ + | sed 's/no support/NA/g' | sed 's/superkingdom/domain/' | sed 's/# ORF/gene_ID/' | sed 's/lineage/taxid/' > ${2} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/generate-assembly-based-overview-table.sh b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/generate-assembly-based-overview-table.sh new file mode 100644 index 000000000..39b3aef08 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/generate-assembly-based-overview-table.sh @@ -0,0 +1,74 @@ +#!/usr/bin/env bash + +sample_IDs_file=${1} +assemblies_dir=${2} +genes_dir=${3} +mapping_dir=${4} +bins_dir=${5} +MAGs_dir=${6} +output=${7} + +# starting output file +printf "Sample_ID\tassembly_produced\tgene_calls_identified\tread_mapping_successful\tbins_recovered\tMAGs_recovered\n" > ${output} + +# looping through all input files and generating columns for final table +for sample in $(cat ${sample_IDs_file}) +do + + # checking assembly + if [ ! -s ${assemblies_dir}/${sample}-assembly.fasta ]; then + printf "No\n" >> assembly-status.tmp + + # removing empty output fasta + rm -rf ${assemblies_dir}/${sample}-assembly.fasta + + else + printf "Yes\n" >> assembly-status.tmp + fi + + # checking gene calls + if [ ! -s ${genes_dir}/${sample}-genes.faa ]; then + printf "No\n" >> genes-status.tmp + + # removing empty output files + rm -rf ${genes_dir}/${sample}-genes.faa ${genes_dir}/${sample}-genes.fasta ${genes_dir}/${sample}-genes.gff + + else + printf "Yes\n" >> genes-status.tmp + fi + + # checking read-mapping outputs + if [ ! -s ${mapping_dir}/${sample}.bam ]; then + printf "No\n" >> mapping-status.tmp + + # removing empty output files + rm -rf ${mapping_dir}/${sample}.bam ${mapping_dir}/${sample}-metabat-assembly-depth.tsv + + else + printf "Yes\n" >> mapping-status.tmp + fi + + # getting number of bins recovered if any produced + if compgen -G "${bins_dir}*.fasta" > /dev/null; then + num_bins=$(ls ${bins_dir}*.fasta | grep -c "${sample}-bin.[0-9]*.fasta") + printf "${num_bins}\n" >> bins-status.tmp + else + printf "0\n" >> bins-status.tmp + fi + + # getting number of MAGs recovered + if compgen -G "${MAGs_dir}*.fasta" >/dev/null; then + num_MAGs=$(ls ${MAGs_dir}*.fasta | grep -c "${sample}-MAG-[0-9]*.fasta") + printf "${num_MAGs}\n" >> MAGs-status.tmp + else + printf "0\n" >> MAGs-status.tmp + fi + +done + +# combining, adding to output file and removing intermediates +cat <( paste ${sample_IDs_file} assembly-status.tmp \ + genes-status.tmp mapping-status.tmp \ + bins-status.tmp MAGs-status.tmp ) >> ${output} + +rm assembly-status.tmp genes-status.tmp mapping-status.tmp bins-status.tmp MAGs-status.tmp diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/generate_protocol.sh b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/generate_protocol.sh new file mode 100755 index 000000000..d15f68b6e --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/generate_protocol.sh @@ -0,0 +1,36 @@ +#!/usr/bin/env bash + +# Generate protocol according to a pipeline document + +# USAGE: +# generate_protocol.sh +# EXAMPLE +# generate_protocol.sh ../Metadata/software_versions.txt GL-DPPD-7107-A + +FASTQC=`grep -i 'fastqc' $1 | awk '{print $2}' |sed -E 's/v//'` +MULTIQC=`grep -i 'multiqc' $1 | awk '{print $3}'` +BBMAP=`grep -i 'bbtools' $1 | awk '{print $2}'` +HUMANN=`grep -i 'humann' $1 | awk '{print $2}'|sed -E 's/v//'` +MEGAHIT=`grep -i 'megahit' $1 | awk '{print $2}'|sed -E 's/v//'` +PRODIGAL=`grep -i 'prodigal' $1 | awk '{print $2}'|sed -E 's/[vV:]//g'` +CAT=`grep 'CAT' $1 | awk '{print $2}'|sed -E 's/v//'` +KOFAMSCAN=`grep 'exec_annotation' $1 | awk '{print $2}'` +BOWTIE2=`grep -i 'bowtie' $1 | awk '{print $3}'` +SAMTOOLS=`grep -i 'samtools' $1 | awk '{print $2}'` +METABAT2=`grep -i 'metabat' $1 | awk '{print $2}'` +BIT=`grep -i 'bioinformatics tools' $1 | awk '{print $3}' | sed 's/v//' | sed -E 's/.+([0-9]+.[0-9]+.[0-9]+).+/\1/'` +CHECKM=`grep -i 'checkm' $1 | awk '{print $2}' |sed -E 's/v//'` +GTDBTK=`grep -i '^GTDB' $1 | awk '{print $2}' |sed -E 's/v//' | head -n2` # If 2 versions are used, choose the second + +PROTOCOL_ID=$2 + +PROTOCOL="Data were processed as described in ${PROTOCOL_ID} (https://github.com/nasa/GeneLab_Data_Processing/blob/master/Metagenomics/Illumina/Pipeline_GL-DPPD-7107_Versions/${PROTOCOL_ID}.md), using workflow NF_MGIllumina v1.0.0 (https://github.com/nasa/GeneLab_Data_Processing/tree/NF_MGIllumina_1.0.0/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina). \ + In breif, quality assessment of reads was performed with FastQC v${FASTQC} and reports were summarized with MultiQC v${MULTIQC}. \ + Quality trimming and filtering were performed with bbmap v${BBMAP}. Read-based processing was performed with humann3 v${HUMANN}. \ + Individual samples were assembled with megahit v${MEGAHIT}. Genes were called with prodigal v${PRODIGAL}. \ + Taxonomic classification of genes and contigs was performed with CAT v${CAT}. Functional annotation was done with KOFamScan v${KOFAMSCAN}. \ + Reads were mapped to assemblies with bowtie2 v${BOWTIE2} and coverage information was extracted for reads and contigs with samtools v${SAMTOOLS} and bbmap v${BBMAP}. \ + Binning of contigs was performed with metabat2 v${METABAT2}. Bins were summarized with bit v${BIT} and estimates of quality were generated with checkm v${CHECKM}. \ + High-quality bins (> 90% est. completeness and < 10% est. redundancy) were taxonomically classified with gtdb-tk v${GTDBTK}." + +echo ${PROTOCOL} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/get_MAGs_estimates_and_taxonomy.sh b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/get_MAGs_estimates_and_taxonomy.sh new file mode 100644 index 000000000..a1c502e0a --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/get_MAGs_estimates_and_taxonomy.sh @@ -0,0 +1,26 @@ +#!/usr/bin/env bash +MAGs_dir=$1 +MAG_assembly_summaries=$2 +MAGs_checkm_out=$3 +gtdbtk_out=$4 + +# Making sure none of the intermediate files exist already +rm -rf checkm-estimates.tmp \ + gtdb-taxonomies.tmp \ + checkm-estimates-with-headers.tmp \ + gtdb-taxonomies-with-headers.tmp \ + MAGs-overview.tmp \ + MAGs-overview-header.tmp \ + MAGs-overview-sorted.tmp +for MAG in $(cut -f 1 ${MAG_assembly_summaries} | tail -n +2); do + + grep -w -m 1 "^${MAG}" ${MAGs_checkm_out} | \ + cut -f 12,13,14 >> checkm-estimates.tmp + + grep -w "^${MAG}" ${gtdbtk_out}/gtdbtk.*.summary.tsv | \ + cut -f 2 | sed 's/^.__//' | \ + sed 's/;.__/\t/g' | \ + awk 'BEGIN{ OFS=FS="\t" } { for (i=1; i<=NF; i++) if ( $i ~ /^ *$/ ) $i = "NA" }; 1' \ + >> gtdb-taxonomies.tmp +done + diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/parse-MAG-annots.py b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/parse-MAG-annots.py new file mode 100644 index 000000000..a0c172fd1 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/parse-MAG-annots.py @@ -0,0 +1,30 @@ +#!/usr/bin/env python + +import argparse + +parser = argparse.ArgumentParser(description='This script does whatever it needs to do.') + +required = parser.add_argument_group('required arguments') + +required.add_argument("-i", "--input-tsv", help='no help for you, come back, 2 years!', action="store", required=True) +required.add_argument("-w", "--wanted-things", help="what'd i tell you?", action="store", required=True) +required.add_argument("-M", "--MAG-ID", action="store", required=True) + +parser.add_argument("-o", "--output_tsv", help='Default: "out.tsv"', action="store", dest="output_tsv", default="out.tsv") + +args = parser.parse_args() + +targets_set = set(line.strip() for line in open(args.wanted_things)) + +out_tab = open(args.output_tsv, "a") + +for line in open(args.input_tsv): + line = line.strip().split("\t") + if line[2] != "NA": + + # dropping last coding seq # field so matches contig ID + if line[0].rsplit('_', 1)[0] in targets_set: + + out_tab.write(str(args.MAG_ID) + "\t" + line[2] + "\n") + +out_tab.close() diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/prepull_singularity.sh b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/prepull_singularity.sh new file mode 100644 index 000000000..125130f16 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/prepull_singularity.sh @@ -0,0 +1,31 @@ +#!/usr/bin/env bash + +# Addresses issue: https://github.com/nextflow-io/nextflow/issues/1210 + +CONFILE=${1:-nextflow.config} +OUTDIR=${2:-./singularity} + +if [ ! -e $CONFILE ]; then + echo "$CONFILE does not exist" + exit +fi + +TMPFILE=`mktemp` + +CURDIR=$(pwd) + +mkdir -p $OUTDIR + +cat ${CONFILE}|grep 'container'|perl -lane 'if ( $_=~/container\s*\=\s*\"(\S+)\"/ ) { $_=~/container\s*\=\s*\"(\S+)\"/; print $1 unless ( $1=~/^\s*$/ or $1=~/\.sif/ or $1=~/\.img/ ) ; }' > $TMPFILE + +cd ${OUTDIR} + +while IFS= read -r line; do + name=$line + name=${name/:/-} + name=${name//\//-} + echo $name + singularity pull ${name}.img docker://$line +done < $TMPFILE + +cd $CURDIR \ No newline at end of file diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/swap-MAG-IDs.py b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/swap-MAG-IDs.py new file mode 100644 index 000000000..830c62dc1 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/bin/swap-MAG-IDs.py @@ -0,0 +1,31 @@ +#!/usr/bin/env python + +import argparse +import pandas as pd + +parser = argparse.ArgumentParser(description='This script swaps the MAG IDs back to what they were prior to running KEGGDecoder.') + +required = parser.add_argument_group('required arguments') + +required.add_argument("-i", "--input-tsv", help='Output table from KEGGDecoder', action="store", required=True) +required.add_argument("-m", "--map-tsv", help='Tab-delimited map with 1st column holding original name, and 2nd column holding modified name', action="store", required=True) + +parser.add_argument("-o", "--output-tsv", help='Output table with adjusted MAG IDs (Default: "out.tsv")', action="store", default="out.tsv") + +args = parser.parse_args() + +# reading in mapping file into dictionary +map_dict = {} +with open(args.map_tsv) as mapping: + for line in mapping: + line = line.strip().split("\t") + map_dict[line[1]] = line[0] + +# reading in output table from KEGGDecoder +in_tab = pd.read_csv(args.input_tsv, sep = "\t", index_col = 0) + +# renaming back to what they were before modifying to be compliant with KEGGDecoder +mod_tab = in_tab.rename(index = map_dict) + +# writing out modified file +mod_tab.to_csv(args.output_tsv, sep = "\t") diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/config/bbtools_adapters.fa b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/config/bbtools_adapters.fa new file mode 100644 index 000000000..a87d4258b --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/config/bbtools_adapters.fa @@ -0,0 +1,317 @@ +>Reverse_adapter +AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Universal_Adapter +AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT +>pcr_dimer +AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG +>PCR_Primers +AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCAAGCAGAAGACGGCATACGAGCTCTTCCGATCT +>TruSeq_Adapter_Index_1_6 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_2 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_3 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_4 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_5 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_6 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_7 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_8 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_9 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_10 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_11 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_12 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_13 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_14 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_15 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_16 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_18_7 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_19 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_20 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCTTATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_21 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTTCGGAATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_22 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTACGTAATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_23 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_25 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATATCTCGTATGCCGTCTTCTGCTTG +>TruSeq_Adapter_Index_27 +GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTATGCCGTCTTCTGCTTG +>I5_Nextera_Transposase_1 +CTGTCTCTTATACACATCTGACGCTGCCGACGA +>I7_Nextera_Transposase_1 +CTGTCTCTTATACACATCTCCGAGCCCACGAGAC +>I5_Nextera_Transposase_2 +CTGTCTCTTATACACATCTCTGATGGCGCGAGGGAGGC +>I7_Nextera_Transposase_2 +CTGTCTCTTATACACATCTCTGAGCGGGCTGGCAAGGC +>I5_Primer_Nextera_XT_and_Nextera_Enrichment_[N/S/E]501 +GACGCTGCCGACGAGCGATCTAGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_and_Nextera_Enrichment_[N/S/E]502 +GACGCTGCCGACGAATAGAGAGGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_and_Nextera_Enrichment_[N/S/E]503 +GACGCTGCCGACGAAGAGGATAGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_and_Nextera_Enrichment_[N/S/E]504 +GACGCTGCCGACGATCTACTCTGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_and_Nextera_Enrichment_[N/S/E]505 +GACGCTGCCGACGACTCCTTACGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_and_Nextera_Enrichment_[N/S/E]506 +GACGCTGCCGACGATATGCAGTGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_and_Nextera_Enrichment_[N/S/E]507 +GACGCTGCCGACGATACTCCTTGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_and_Nextera_Enrichment_[N/S/E]508 +GACGCTGCCGACGAAGGCTTAGGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_and_Nextera_Enrichment_[N/S/E]517 +GACGCTGCCGACGATCTTACGCGTGTAGATCTCGGTGGTCGCCGTATCATT +>I7_Primer_Nextera_XT_and_Nextera_Enrichment_N701 +CCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_and_Nextera_Enrichment_N702 +CCGAGCCCACGAGACCGTACTAGATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_and_Nextera_Enrichment_N703 +CCGAGCCCACGAGACAGGCAGAAATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_and_Nextera_Enrichment_N704 +CCGAGCCCACGAGACTCCTGAGCATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_and_Nextera_Enrichment_N705 +CCGAGCCCACGAGACGGACTCCTATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_and_Nextera_Enrichment_N706 +CCGAGCCCACGAGACTAGGCATGATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_and_Nextera_Enrichment_N707 +CCGAGCCCACGAGACCTCTCTACATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_and_Nextera_Enrichment_N708 +CCGAGCCCACGAGACCAGAGAGGATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_and_Nextera_Enrichment_N709 +CCGAGCCCACGAGACGCTACGCTATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_and_Nextera_Enrichment_N710 +CCGAGCCCACGAGACCGAGGCTGATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_and_Nextera_Enrichment_N711 +CCGAGCCCACGAGACAAGAGGCAATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_and_Nextera_Enrichment_N712 +CCGAGCCCACGAGACGTAGAGGAATCTCGTATGCCGTCTTCTGCTTG +>I5_Primer_Nextera_XT_Index_Kit_v2_S502 +GACGCTGCCGACGAATAGAGAGGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_Index_Kit_v2_S503 +GACGCTGCCGACGAAGAGGATAGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_Index_Kit_v2_S505 +GACGCTGCCGACGACTCCTTACGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_Index_Kit_v2_S506 +GACGCTGCCGACGATATGCAGTGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_Index_Kit_v2_S507 +GACGCTGCCGACGATACTCCTTGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_Index_Kit_v2_S508 +GACGCTGCCGACGAAGGCTTAGGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_Index_Kit_v2_S510 +GACGCTGCCGACGAATTAGACGGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_Index_Kit_v2_S511 +GACGCTGCCGACGACGGAGAGAGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_Index_Kit_v2_S513 +GACGCTGCCGACGACTAGTCGAGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_Index_Kit_v2_S515 +GACGCTGCCGACGAAGCTAGAAGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_Index_Kit_v2_S516 +GACGCTGCCGACGAACTCTAGGGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_Index_Kit_v2_S517 +GACGCTGCCGACGATCTTACGCGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_Index_Kit_v2_S518 +GACGCTGCCGACGACTTAATAGGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_Index_Kit_v2_S520 +GACGCTGCCGACGAATAGCCTTGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_Index_Kit_v2_S521 +GACGCTGCCGACGATAAGGCTCGTGTAGATCTCGGTGGTCGCCGTATCATT +>I5_Primer_Nextera_XT_Index_Kit_v2_S522 +GACGCTGCCGACGATCGCATAAGTGTAGATCTCGGTGGTCGCCGTATCATT +>I7_Primer_Nextera_XT_Index_Kit_v2_N701 +CCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N702 +CCGAGCCCACGAGACCGTACTAGATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N703 +CCGAGCCCACGAGACAGGCAGAAATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N704 +CCGAGCCCACGAGACTCCTGAGCATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N705 +CCGAGCCCACGAGACGGACTCCTATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N706 +CCGAGCCCACGAGACTAGGCATGATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N707 +CCGAGCCCACGAGACCTCTCTACATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N710 +CCGAGCCCACGAGACCGAGGCTGATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N711 +CCGAGCCCACGAGACAAGAGGCAATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N712 +CCGAGCCCACGAGACGTAGAGGAATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N714 +CCGAGCCCACGAGACGCTCATGAATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N715 +CCGAGCCCACGAGACATCTCAGGATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N716 +CCGAGCCCACGAGACACTCGCTAATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N718 +CCGAGCCCACGAGACGGAGCTACATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N719 +CCGAGCCCACGAGACGCGTAGTAATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N720 +CCGAGCCCACGAGACCGGAGCCTATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N721 +CCGAGCCCACGAGACTACGCTGCATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N722 +CCGAGCCCACGAGACATGCGCAGATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N723 +CCGAGCCCACGAGACTAGCGCTCATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N724 +CCGAGCCCACGAGACACTGAGCGATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N726 +CCGAGCCCACGAGACCCTAAGACATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N727 +CCGAGCCCACGAGACCGATCAGTATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N728 +CCGAGCCCACGAGACTGCAGCTAATCTCGTATGCCGTCTTCTGCTTG +>I7_Primer_Nextera_XT_Index_Kit_v2_N729 +CCGAGCCCACGAGACTCGACGTCATCTCGTATGCCGTCTTCTGCTTG +>I5_Adapter_Nextera +CTGATGGCGCGAGGGAGGCGTGTAGATCTCGGTGGTCGCCGTATCATT +>I7_Adapter_Nextera_No_Barcode +CTGAGCGGGCTGGCAAGGCAGACCGATCTCGTATGCCGTCTTCTGCTTG +>Nextera_LMP_Read1_External_Adapter +GATCGGAAGAGCACACGTCTGAACTCCAGTCAC +>Nextera_LMP_Read2_External_Adapter +GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT +>RNA_Adapter_(RA5)_part_#_15013205 +GATCGTCGGACTGTAGAACTCTGAAC +>RNA_Adapter_(RA3)_part_#_15013207 +CCTTGGCACCCGAGAATTCCA +>Stop_Oligo_(STP)_8 +CCACGGGAACGTGGTGGAATTC +>RNA_RT_Primer_(RTP)_part_#_15013981 +TGGAATTCTCGGGTGCCAAGGC +>RNA_PCR_Primer_(RP1)_part_#_15013198 +TCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTATCATT +>RNA_PCR_Primer_Index_1_(RPI1)_2,9 +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_2_(RPI2) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_3_(RPI3) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_4_(RPI4) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_5_(RPI5) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_6_(RPI6) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_7_(RPI7) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_8_(RPI8) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_9_(RPI9) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_10_(RPI10) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_11_(RPI11) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_12_(RPI12) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_13_(RPI13) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAGTCAAATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_14_(RPI14) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAGTTCCATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_15_(RPI15) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATGTCAATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_16_(RPI16) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCCGTCCATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_17_(RPI17) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTAGAGATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_18_(RPI18) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTCCGCATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_19_(RPI19) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTGAAAATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_20_(RPI20) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTGGCCATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_21_(RPI21) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTTTCGATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_22_(RPI22) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGTACGATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_23_(RPI23) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGAGTGGATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_24_(RPI24) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGGTAGCATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_25_(RPI25) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTGATATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_26_(RPI26) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_27_(RPI27) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATTCCTATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_28_(RPI28) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAAAAGATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_29_(RPI29) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAACTAATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_30_(RPI30) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCACCGGATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_31_(RPI31) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCACGATATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_32_(RPI32) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCACTCAATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_33_(RPI33) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAGGCGATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_34_(RPI34) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCATGGCATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_35_(RPI35) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCATTTTATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_36_(RPI36) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCCAACAATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_37_(RPI37) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGGAATATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_38_(RPI38) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCTAGCTATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_39_(RPI39) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCTATACATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_40_(RPI40) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCTCAGAATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_41_(RPI41) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGACGACATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_42_(RPI42) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTAATCGATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_43_(RPI43) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTACAGCATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_44_(RPI44) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTATAATATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_45_(RPI45) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTCATTCATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_46_(RPI46) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTCCCGAATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_47_(RPI47) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTCGAAGATCTCGTATGCCGTCTTCTGCTTG +>RNA_PCR_Primer_Index_48_(RPI48) +TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTCGGCAATCTCGTATGCCGTCTTCTGCTTG +>PhiX_read1_adapter +AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTGAAA +>PhiX_read2_adapter +AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA +>Bisulfite_R1 +AGATCGGAAGAGCACACGTCTGAAC +>Bisulfite_R2 +AGATCGGAAGAGCGTCGTGTAGGGA +>Illumina Small RNA v1.5 3p Adapter +ATCTCGTATGCCGTCTTCTGCTTG +>Illumina RNA 3p Adapter (RA3) +TGGAATTCTCGGGTGCCAAGG +>Illumina RNA 5p Adapter (RA5) +GTTCAGAGTTCTACAGTCCGACGATC +>Illumina 3p RNA Adapter +TCGTATGCCGTCTTCTGCTTGT + diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/config/multiqc.config b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/config/multiqc.config new file mode 100644 index 000000000..e3bd4ac00 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/config/multiqc.config @@ -0,0 +1,7 @@ +extra_fn_clean_exts: + - "_raw" + - "_HRremoved_raw" + - "_filtered" + +show_analysis_paths: False +show_analysis_time: False diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/bit.yaml b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/bit.yaml new file mode 100644 index 000000000..6e39c1378 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/bit.yaml @@ -0,0 +1,7 @@ +channels: + - conda-forge + - bioconda + - defaults + - astrobiomike +dependencies: + - bit=1.8.53 diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/cat.yaml b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/cat.yaml new file mode 100644 index 000000000..545c1870b --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/cat.yaml @@ -0,0 +1,7 @@ +name: CAT +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - cat=5.2.3 diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/checkm.yaml b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/checkm.yaml new file mode 100644 index 000000000..d52e414c3 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/checkm.yaml @@ -0,0 +1,7 @@ +name: checkm +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - checkm-genome=1.1.3 diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/genelab.yaml b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/genelab.yaml new file mode 100644 index 000000000..9f2ec80b7 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/genelab.yaml @@ -0,0 +1,8 @@ +name: genelab-utils +channels: + - conda-forge + - bioconda + - defaults + - astrobiomike +dependencies: + - genelab-utils==1.3.22=py312_1 \ No newline at end of file diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/gtdb-tk.yaml b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/gtdb-tk.yaml new file mode 100644 index 000000000..90ca8d589 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/gtdb-tk.yaml @@ -0,0 +1,6 @@ +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - gtdbtk=2.4.0 diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/humann3.yaml b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/humann3.yaml new file mode 100644 index 000000000..fa616b0d7 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/humann3.yaml @@ -0,0 +1,8 @@ +channels: + - conda-forge + - bioconda + - defaults + - biobakery +dependencies: + - humann=3.9 + - metaphlan=4.10 \ No newline at end of file diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/image_def.bit b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/image_def.bit new file mode 100644 index 000000000..e4730aeb6 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/image_def.bit @@ -0,0 +1,32 @@ +FROM continuumio/anaconda3:2024.02-1 + +MAINTAINER Olabiyi Obayomi + +RUN /opt/conda/bin/conda init bash && \ + /opt/conda/bin/conda config --add channels bioconda && \ + /opt/conda/bin/conda config --add channels conda-forge && \ + /opt/conda/bin/conda update conda -y && \ + /opt/conda/bin/conda clean -afy + +# copy the necessary files +COPY bit.yaml ./ + +RUN apt-get --allow-releaseinfo-change update && \ + apt-get upgrade -y && \ + dpkg --configure -a + +# Install environment +RUN conda env create -f bit.yaml && \ + conda clean --all + +RUN apt-get clean && \ + apt-get autoremove + +RUN echo "source activate /opt/conda/envs/bit/" > ~/.bashrc + +RUN apt-get install -y groff + +ENV PATH="/opt/conda/envs/bit/bin/:$PATH" + +RUN apt-get install -y procps +CMD ["/bin/bash"] diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/image_def.genelab b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/image_def.genelab new file mode 100644 index 000000000..a9b44d694 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/image_def.genelab @@ -0,0 +1,32 @@ +FROM continuumio/anaconda3:2024.02-1 + +MAINTAINER Olabiyi Obayomi + +RUN /opt/conda/bin/conda init bash && \ + /opt/conda/bin/conda config --add channels bioconda && \ + /opt/conda/bin/conda config --add channels conda-forge && \ + /opt/conda/bin/conda update conda -y && \ + /opt/conda/bin/conda clean -afy + +# copy the necessary files +COPY genelab.yaml ./ + +RUN apt-get --allow-releaseinfo-change update && \ + apt-get upgrade -y && \ + dpkg --configure -a + +# Install environment +RUN conda env create -f genelab.yaml && \ + conda clean --all + +RUN apt-get clean && \ + apt-get autoremove + +RUN echo "source activate /opt/conda/envs/genelab-utils/" > ~/.bashrc + +RUN apt-get install -y groff + +ENV PATH="/opt/conda/envs/genelab-utils/bin/:$PATH" + +RUN apt-get install -y procps +CMD ["/bin/bash"] diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/keggdecoder.yaml b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/keggdecoder.yaml new file mode 100644 index 000000000..9ec5e2b7c --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/keggdecoder.yaml @@ -0,0 +1,7 @@ +channels: + - conda-forge +dependencies: + - python=3.6 + - pip + - pip: + - KEGGDecoder==1.2.2 diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/kofamscan.yaml b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/kofamscan.yaml new file mode 100644 index 000000000..6f5654f8a --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/kofamscan.yaml @@ -0,0 +1,9 @@ +channels: + - conda-forge + - bioconda + - defaults + - astrobiomike +dependencies: + - kofamscan=1.3.0 + - hmmer=3.3.0 + - bit=1.8.53 diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/mapping.yaml b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/mapping.yaml new file mode 100644 index 000000000..a31c7e76c --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/mapping.yaml @@ -0,0 +1,9 @@ +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - bowtie2=2.4.1 + - tbb=2020.2 + - bbmap=38.86 + - samtools=1.2 diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/megahit.yaml b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/megahit.yaml new file mode 100644 index 000000000..42fa709a7 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/megahit.yaml @@ -0,0 +1,8 @@ +channels: + - conda-forge + - bioconda + - defaults + - astrobiomike +dependencies: + - megahit=1.2.9 + - bit=1.8.53 diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/metabat.yaml b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/metabat.yaml new file mode 100644 index 000000000..de7774a27 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/metabat.yaml @@ -0,0 +1,6 @@ +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - metabat2=2.15 diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/prodigal.yaml b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/prodigal.yaml new file mode 100644 index 000000000..4872bf98b --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/prodigal.yaml @@ -0,0 +1,8 @@ +channels: + - conda-forge + - bioconda + - defaults + - astrobiomike +dependencies: + - prodigal=2.6.3 + - bit=1.8.53 diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/qc.yaml b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/qc.yaml new file mode 100644 index 000000000..3838ce5da --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/envs/qc.yaml @@ -0,0 +1,10 @@ +channels: + - conda-forge + - bioconda + - defaults +dependencies: + - fastqc=0.12.1 + - multiqc=1.19 + - bbmap=38.86 + - zip=3.0 + - python=3.8 diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/launch.sh b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/launch.sh new file mode 100755 index 000000000..0e6b2bec8 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/launch.sh @@ -0,0 +1,102 @@ +#!/usr/bin/env bash +set -euo pipefail + +# Script to launch a nextflow workflow on slurm cluster + +# Usage: bash ./launch.sh [mode] [main.nf] [config] '[extra arguments]' +# Examples + +# Processing: +# bash ./launch.sh processing path/to/main.nf path/to/nextflow.config '--accession OSD-574' + +# Postprocessing: +# bash ./launch.sh post_processing path/to/post_processing.nf path/to/post_processing.config \ +# '--name FirstNAme M. LastName --email email@doamin.com --GLDS_accession GLDS-574 --OSD_accession OSD-574 --isa_zip ../GeneLab/OSD-574_metadata_GLDS-574-ISA.zip --runsheet ../GeneLab/GLfile.csv' + + + +MODE=${1:-''} # Script run mode i.e. processing or post_processing +MAIN=${2:-''} # Path to the main.nf or post_processing.nf nextflow script for processing and post_processing, respectively. +CONFIG=${3:-''} # nextflow config file i.e. nextflow.config or post_processing.config +EXTRA=${4:-''} # extra arguments to the nextflow run command + + +#============================================================================== +# SETUP START +#============================================================================== +eval "$(conda shell.bash hook)" +conda activate /path/to/conda/envs/nextflow +export NXF_SINGULARITY_CACHEDIR= +export TOWER_ACCESS_TOKEN= +export TOWER_WORKSPACE_ID= + +#============================================================================== +# UMASK CONFIGURATION +#============================================================================== +echo "Setting umask to enable group read-access by default" +umask u=rwx,g=rx +echo "Umask settings for this launch: $(umask -S)" + + +#============================================================================== +# NEXTFLOW COMMAND START +#============================================================================== +if [ ${MODE} == "processing" ]; then + + RUN_NAME=MAIN_$(date +%Y%m%d%H%M%S) + + RUN_COMMAND="nextflow -C ${CONFIG} + run \ + -name ${RUN_NAME} \ + ${MAIN} \ + -resume \ + -profile slurm,singularity \ + -with-tower \ + -process.queue 'normal' \ + -ansi-log false \ + ${EXTRA}" + + echo "Running command: ${RUN_COMMAND}" + echo "" + [ -d processing_scripts ] || mkdir processing_scripts + eval ${RUN_COMMAND} && echo ${RUN_COMMAND} > processing_scripts/command.txt + + # Save the nextflow log to a file + echo "Creating Nextflow processing info file..." + nextflow log ${RUN_NAME} -f name,script > processing_scripts/nextflow_processing_info_GLmetagenomics.txt + echo nextflow log ${RUN_NAME} -f name,script >> processing_scripts/nextflow_processing_info_GLmetagenomics.txt + echo "Nextflow processing info written to processing_scripts/nextflow_processing_info_GLmetagenomics.txt" + + +elif [ ${MODE} == "post_processing" ];then + + + RUN_NAME=POST_$(date +%Y%m%d%H%M%S) + + RUN_COMMAND="nextflow -C ${CONFIG} + run \ + -name ${RUN_NAME} \ + ${MAIN} \ + -resume \ + -profile slurm,singularity \ + -with-tower \ + -process.queue 'normal' \ + -ansi-log false \ + ${EXTRA}" + + echo "Running command: ${RUN_COMMAND}" + echo "" + eval ${RUN_COMMAND} + +else + echo 'Please provide a valid mode to run the workflow.' + echo 'Either processing or post_processing for running the processing or post_processing workflows, respectively.' + exit 1 +fi + + +# Set permissions on launch directory +echo "" +echo "Setting permissions on launch directory..." +chmod -R 755 . +echo "Permissions set to 755 recursively on launch directory" diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/launch.slurm b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/launch.slurm new file mode 100755 index 000000000..c2403403f --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/launch.slurm @@ -0,0 +1,51 @@ +#!/bin/bash + +#SBATCH --job-name="nf_master" ## Replace job_name with the name of the job you are running ## +#SBATCH --output=nf_master.o.%j ## Replace job_name with the name of the job you are running ## +#SBATCH --error=nf_master.e.%j ## Replace job_name with the name of the job you are running ## +#SBATCH --partition=normal ## Specifies the job queue to use, for urgent jobs change normal to priority ## +#SBATCH --mem=20G ## Memory required to run the job in MB, this example is showing 10,000 MB or 10GB, change this number based on how much RAM you need ## +#SBATCH --cpus-per-task=1 ## Number of CPUs to run the job, this example is showing 5 CPUs, change this number based on how many CPUs you need ## +#SBATCH --mail-user=name@domain.com ## Specifies the e-mail address to e-mail when the job is complete, replace this e-mail address with your NASA e-mail address ## +#SBATCH --mail-type=END ## Tells slurm to e-mail the address above when the job has completed ## + +. ~/.profile + + +echo "nf_master" ## Replace job_name with the name of the job you are running ## +echo "" + + +## Add a time-stamp at the start of the job ## +start=$(date +%s) +echo "start time: $start" + +## Print the name of the compute node executing the job ## +echo $HOSTNAME + +WORKFLOW_DIR='/path/to/nextflow/workflow_code' +# Processing +bash ./launch.sh processing ${WORKFLOW_DIR}/main.nf ${WORKFLOW_DIR}/nextflow.config '--accession OSD-574' + +# Post Processing +#bash ./launch.sh post_processing ${WORKFLOW_DIR}/post_processing.nf ${WORKFLOW_DIR}/post_processing.config \ +# '--name First M. Last --email name@domain.com --GLDS_accession GLDS-574 --OSD_accession OSD-574 --isa_zip ../GeneLab/OSD-574_metadata_OSD-574-ISA.zip --runsheet ../GeneLab/GLfile.csv' + + +## Add a time-stamp at the end of the job then calculate how long the job took to run in seconds, minutes, and hours ## +echo "" +end=$(date +%s) +echo "end time: $end" +runtime_s=$(echo $(( end - start ))) +echo "total run time(s): $runtime_s" +sec_per_min=60 +sec_per_hr=3600 +runtime_m=$(echo "scale=2; $runtime_s / $sec_per_min;" | bc) +echo "total run time(m): $runtime_m" +runtime_h=$(echo "scale=2; $runtime_s / $sec_per_hr;" | bc) +echo "total run time(h): $runtime_h" +echo "" + + +## Print the slurm job ID so you have it recorded and can view slurm job statistics if needed ## +echo "slurm job ID: ${SLURM_JOB_ID}" diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/main.nf b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/main.nf new file mode 100644 index 000000000..f7d974107 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/main.nf @@ -0,0 +1,415 @@ +#!/usr/bin/env nextflow +nextflow.enable.dsl=2 + +// Terminal text color defintions +c_back_bright_red = "\u001b[41;1m"; +c_bright_green = "\u001b[32;1m"; +c_blue = "\033[0;34m"; +c_reset = "\033[0m"; + +params.help = false + +/************************************************** +* HELP MENU ************************************** +**************************************************/ +if (params.help) { + println() + println("Nextflow Metagenomics Illumina Consensus Pipeline: $workflow.manifest.version") + println("USAGE:") + println("Example 1: Submit and run jobs with slurm in singularity containers.") + println(" > nextflow run main.nf -resume -profile slurm,singularity --input_file PE_file.csv") + println() + println("Example 2: : Submit and run jobs with slurm in conda environments.") + println(" > nextflow run main.nf -resume -profile slurm,conda --input_file SE_file.csv") + println() + println("Example 3: Run jobs locally in conda environments, supply a GLDS accession, and specify the path to an existing conda environment.") + println(" > nextflow run main.nf -resume -profile mamba --accession OSD-574 --conda_megahit ") + println() + println("Required arguments:") + println("""-profile [STRING] Specifies the profile to be used to run the workflow. Options are [slurm, singularity, docker, and conda]. + singularity, docker and conda will run the pipeline locally using singularity, docker, and conda, respectively. + To combine profiles, separate two or more profiles with comma. For example, to combine slurm and singularity profiles, pass 'slurm,singularity' as argument. """) + println("--input_file [PATH] A 3-column (single-end) or 4-column (paired-end) csv input file (sample_id, forward, [reverse,] paired). Required only if a GLDS accession is not provided. Default : null") + println(" Please see the files: examples/runsheet/single_end_dataset/SE_file.csv and examples/runsheet/paired_end_dataset/PE_file.csv for single-end and paired-end examples, respectively.") + println(" The sample_id column should contain unique sample ids.") + println(" The forward and reverse columns should contain the absolute or relative path to the sample's forward and reverse reads.") + println(" The paired column should be true for paired-end or anything else for single-end reads.") + println() + println("Optional arguments:") + println(" --help Print this help message and exit") + println(" --workflow [STRING] Specifies that workflow to be run. Options are one of [read-based, assembly-based, both]. Default: both.") + println(" --publishDir_mode [STRING] Specifies how nextflow handles output file publishing. Options can be found here https://www.nextflow.io/docs/latest/process.html#publishdir Default: link.") + println(" --errorStrategy [STRING] Specifies how nextflow handles errors. Options can be found here https://www.nextflow.io/docs/latest/process.html#errorstrategy. Default: ignore") + println(" --swift_1S [BOOLEAN] Setting for trimming recommended when working with Swift 1S libraries.") + println(" adds `swift=t` setting to bbduk quality trimming/filtering command. For info on this, see example, ") + println(" https://swiftbiosci.com/wp-content/uploads/2019/03/16-0853-Tail-Trim-Final-442019.pdf.") + println(" Set to true if data was generated with Swift 1S library prep. Default: false.") + println(" --adapters [PATH] Path to BBtools adapters for reads filtering. Default: config/bbtools_adapters.fa.") + println(" --multiqc_config [PATH] Path to a custom multiqc config file. Default: config/multiqc.config.") + println(" --use_gtdbtk_scratch_location [BOOLEAN] Should a scratch location be used to store GTDBTK temp files? true or false.") + println(" Scratch directory for gtdb-tk, if wanting to use disk space instead of RAM, can be memory intensive;") + println(" see https://ecogenomics.github.io/GTDBTk/faq.html#gtdb-tk-reaches-the-memory-limit-pplacer-crashes") + println(" leave empty if wanting to use memory, the default, put in quotes the path to a directory that") + println(" already exists if wanting to use disk space. Default: false.") + println() + println("MAG parameters: MAG filtering cutoffs based on checkm quality assessments (in percent); see https://github.com/Ecogenomics/CheckM/wiki/Reported-Statistics.") + println(" --min_est_comp [INT] Minimum estimated completion. Default: 90.") + println(" --max_est_redund [INT] Minimum estimated redundancy. Default: 10.") + println(" --max_est_strain_het [INT] Minimum estimated strain heterogeneity. Default: 50.") + println(" --reduced_tree [STRING] reduced_tree option for checkm, limits the RAM usage to 16GB; https://github.com/Ecogenomics/CheckM/wiki/Genome-Quality-Commands#tree.") + println(" 'True' for yes, anything else will be considered 'False' and the default full tree will be used. Default: 'True'. ") + println(" --max_mem [INT] Maximum memory allowed, passed to megahit assembler. Can be set either by proportion of available on system, e.g. 0.5") + println(" or by absolute value in bytes, e.g. 100e9 would be 100 GB. Default: 100e9.") + println() + println(" --pileup_mem [STRING] pileup.sh paramater for calculating contig coverage and depth. Memory used by bbmap's pileup.sh (within the GET_COV_AND_DET process). ") + println(" passed as the -Xmx parameter, 20g means 20 gigs of RAM, 20m means 20 megabytes.") + println(" 5g should be sufficient for most assemblies, but if that rule is failing, this may need to be increased.Default: '5g' .") + println(" --block_size [int] Block size variable for CAT/diamond, lower value means less RAM usage; see https://github.com/bbuchfink/diamond/wiki/3.-Command-line-options#memory--performance-options. Default: 4.") + println() + println("File Suffixes:") + println(" --filtered_suffix [STRING] Specifies the suffix for naming quality filtered reads. Only applicable when input reads are single-end. Default: _filtered.fastq.gz.") + println(" --filtered_R1_suffix [STRING] Specifies the suffix for naming quality filtered forward reads. Default: _R1_filtered.fastq.gz.") + println(" --filtered_R2_suffix [STRING] Specifies the suffix for naming quality filtered reverse reads. Default: _R2_filtered.fastq.gz.") + println() + println("Output directories:") + println(" --raw_reads_dir [PATH] Specifies where the fastqc report of the raw reads will be published. Default: ../Raw_Sequence_Data/.") + println(" --fastqc_out_dir [PATH] Specifies where multiqc outputs will be published. Default: ../FastQC_Outputs/.") + println(" --filtered_reads_dir [PATH] Specifies where filtered reads will be published. Default: ../Filtered_Sequence_Data/.") + println(" --assembly_based_dir [PATH] Specifies where the results of assembly-based analysis will be published. Default: ../Assembly-based_Processing/.") + println(" --assemblies_dir [PATH] Specifies where assemblies will be published. Default: ../Assembly-based_Processing/assemblies/.") + println(" --genes_dir [PATH] Specifies where predicted genes from the assemblies will be published. Default: ../Assembly-based_Processing/predicted-genes/.") + println(" --annotations_and_tax_dir [PATH] Contig taxonomy and annotation directory. Default: ../Assembly-based_Processing/annotations-and-taxonomy/.") + println(" --mapping_dir [PATH] Read mapping to assembly directory. Default: ../Assembly-based_Processing/read-mapping/.") + println(" --combined_output_dir [PATH] Assembly summaries and reports across samples directory. Default: ../Assembly-based_Processing/combined-outputs/.") + println(" --bins_dir [PATH] Assembly bins directory. Default: ../Assembly-based_Processing/bins/.") + println(" --MAGs_dir [PATH] Meta assembled genomes (MAGs) directory. Default: ../Assembly-based_Processing/MAGs/.") + println(" --read_based_dir [PATH] Read-based analysis outputs directory. Default: ../Read-based_Processing/.") + println() + println("Genelab specific arguements:") + println(" --accession [STRING] A Genelab accession number if the --input_file parameter is not set. If this parameter is set, it will ignore the --input_file parameter. Default: null.") + println(" --RawFilePattern [STRING] If we do not want to download all files (which we often won't), we can specify a pattern here to subset the total files.") + println(" For example, if we know we want to download just the fastq.gz files, we can say 'fastq.gz'. We can also provide multiple patterns") + println(" as a comma-separated list. For example, If we want to download the fastq.gz files that also have 'NxtaFlex', 'metagenomics', and 'raw' in") + println(" their filenames, we can provide '-p fastq.gz,NxtaFlex,metagenomics,raw'. Default: null.") + println(" --assay_suffix [STRING] Genelab's assay suffix. Default: _GLmetagenomics.") + println(" --additional_filename_prefix [STRING] additional prefix to add to output files that describe more than one sample (to make them unique compared to other datasets).") + println(" include separator at end if adding one, e.g. Swift1S_ if wanted. Default: empty string .") + println() + println("Paths to existing databases and database links.") + println(" --DB_ROOT [PATH] FULL PATH to root directory where the databases will be downloaded if they don't exist.") + println(" Relative paths such as '~/' and '../' will fail, please don't use them. Default: ../Reference_DBs/ ") + println("CAT database directory strings:") + println(" The strings below will be added to the end of the --database.cat_db path arguement provided below.") + println(" --cat_taxonomy_dir [PATH] CAT taxonomy database directory. Default: 2021-01-07_taxonomy/.") + println(" --cat_db_sub_dir [PATH] CAT database sub directory. Default: 2021-01-07_CAT_database/.") + println(" --CAT_DB_LINK [URL] CAT database online download link. Default: https://tbb.bio.uu.nl/bastiaan/CAT_prepare/CAT_prepare_20210107.tar.gz.") + println("CAT database ") + println(" --cat_db [PATH] Path to CAT database. Example, /path/to/Reference_DBs/CAT_prepare_20210107/. Default: null.") + println("Humann database:") + println(" --metaphlan_db_dir [PATH] Path to metaphlan database. Example, /path/to/Reference_DBs/metaphlan4-db/. Default: null.") + println(" --chocophlan_dir [PATH] Path to Humann's chocophlan nucleotide database. Example, /path/to/Reference_DBs/humann3-db/chocophlan/. Default: null.") + println(" --uniref_dir [PATH] Path to Humann's Uniref protein database. Example, /path/to/Reference_DBs/humann3-db/uniref/. Default: null.") + println(" --utilities_dir [PATH] Path to Humann's untilities database. Example, /path/to/Reference_DBs/humann3-db/utility_mapping/. Default: null.") + println("GTDBTK database:") + println(" --GTDBTK_LINK [URL] GTDBTK database online download link. Default: https://data.gtdb.ecogenomic.org/releases/release220/220.0/auxillary_files/gtdbtk_package/full_package/gtdbtk_r220_data.tar.gz.") + println(" --gtdbtk_db_dir [PATH] Path to GTDBTK database. Example, /path/Reference_DBs/GTDB-tk-ref-db/. Default: null.") + println("kofam scan database database:") + println(" --ko_db_dir [PATH] Path to kofam scan database. Example, /path/to/Reference_DBs/kofamscan_db/. Default: null.") + println() + println("Paths to existing conda environments to use, otherwise, new ones will be created using the yaml files in envs/.") + println(" --conda_qc [PATH] Path to a conda environment containing fastqc, multiqc, zip and python. Default: null.") + println(" --conda_humann3 [PATH] Path to a conda environment with humann3 installed. Default: null.") + println(" --conda_cat [PATH] Path to a conda environment containing CAT (Contig annotation tool). Default: null.") + println(" --conda_prodigal [PATH] Path to a conda environment with prodigal installed. Default: null.") + println(" --conda_metabat [PATH] Path to a conda environment containing metabat. Default: null.") + println(" --conda_gtdbtk [PATH] Path to a conda environment containing gtdbtk. Default: null.") + println(" --conda_kegg_decoder [PATH] Path to a conda environment with kegg_decoder installed. Default: null.") + println(" --conda_megahit [PATH] Path to a conda environment containing megahit. Default: null.") + println(" --conda_bit [PATH] Path to a conda environment with bit installed. Default: null.") + println(" --conda_kofamscan [PATH] Path to a conda environment containing KOFAM SCAN. Default: null.") + println(" --conda_mapping [PATH] Path to a conda environment with bowtie and samtools installed. Default: null.") + println(" --conda_checkm [PATH] Path to a conda environment with checkm installed. Default: null.") + println() + print("Advanced users can edit the nextflow.config file for more control over default settings such container choice, number of cpus, memory per task etc.") + exit 0 + } + +/************************************************ +*********** Show pipeline parameters ************ +*************************************************/ + +if (params.debug) { +log.info """${c_blue} + Nextflow Metagenomics Illumina Consensus Pipeline: $workflow.manifest.version + + You have set the following parameters: + Profile: ${workflow.profile} + Input csv file : ${params.input_file} + GLDS or OSD Accession : ${params.accession} + GLDS Raw File Pattern: ${params.RawFilePattern} + Workflow : ${params.workflow} + Nextflow Directory publishing mode: ${params.publishDir_mode} + Swift 1S Libraries: ${params.swift_1S} + Nextflow Error strategy: ${params.errorStrategy} + BBDUK Adapters: ${params.adapters} + Use GTDBTK Scratch Location: ${params.use_gtdbtk_scratch_location} + MultiQC configuration file: ${params.multiqc_config} + Megahit Maximum Memory: ${params.max_mem} + Pile-up Memory: ${params.pileup_mem} + CAT block size: ${params.block_size} + + File Suffixes: + Filtered Reads Suffix (if single-end): ${params.filtered_suffix} + Filtered Forward Reads Suffix: ${params.filtered_R1_suffix} + Filtered Reverse Reads Suffix: ${params.filtered_R2_suffix} + + MAG Parameters: + Minimum completion: ${params.min_est_comp} + Maximum redundancy: ${params.max_est_redund} + Maximum strain heterogeneity: ${params.max_est_strain_het} + Use Reduced Tree: ${params.reduced_tree} + + Output Directories: + Raw reads: ${params.raw_reads_dir} + FastQC: ${params.fastqc_out_dir} + Filtered Reads: ${params.filtered_reads_dir} + Assembly-based Analysis: ${params.assembly_based_dir} + Assemblies: ${params.assemblies_dir} + Predicted Genes: ${params.genes_dir} + Contigs Taxonomy and Annotation: ${params.annotations_and_tax_dir} + Read mapping: ${params.mapping_dir} + Assemblies Summary: ${params.combined_output_dir} + Bins: ${params.bins_dir} + Meta Assembled Genomes (MAGs): ${params.MAGs_dir} + Read-based Analysis: ${params.read_based_dir} + + Genelab Assay Suffix: ${params.assay_suffix} + Additional Filename Prefix: ${params.additional_filename_prefix} + + Conda Environments: + qc: ${params.conda_qc} + humann3: ${params.conda_humann3} + CAT: ${params.conda_cat} + prodigal: ${params.conda_prodigal} + metabat: ${params.conda_metabat} + gtdbtk: ${params.conda_gtdbtk} + kegg decoder: ${params.conda_kegg_decoder} + megahit: ${params.conda_megahit} + bit: ${params.conda_bit} + kofamscan: ${params.conda_kofamscan} + mapping: ${params.conda_mapping} + checkm: ${params.conda_checkm} + + Databases: + CAT Taxonomy: ${params.cat_taxonomy_dir} + CAT DB sub directory: ${params.cat_db_sub_dir} + CAT URL: ${params.CAT_DB_LINK} + CAT DB: ${params.cat_db} + KOFAM Scan: ${params.ko_db_dir} + Metaphlan: ${params.metaphlan_db_dir} + Chocophlan: ${params.chocophlan_dir} + Uniref: ${params.uniref_dir} + Utilities: ${params.utilities_dir} + GTDBTK URL: ${params.GTDBTK_LINK} + GTDBTK DB: ${params.gtdbtk_db_dir} + ${c_reset}""" +} + +// Create GLDS runsheet +include { GET_RUNSHEET } from "./modules/create_runsheet.nf" + +// Make Humann3 database +include { make_humann_db } from "./modules/database_creation.nf" + +// Read quality check and filtering +include { quality_check as raw_qc; BBDUK } from "./modules/quality_assessment.nf" +include { quality_check as filtered_qc } from "./modules/quality_assessment.nf" + +// Read-based workflow +include { read_based } from "./modules/read_based_processing.nf" + +// Assembly-based workflow +include { assembly_based } from "./modules/assembly_based_processing.nf" + + +// Workflow to perform read-based analysis +workflow run_read_based_analysis { + + + take: + filtered_ch + + main: + + // If any of the four databases does not exist i.e. the paramater is set to null + if(!params.chocophlan_dir || !params.uniref_dir || + !params.metaphlan_db_dir || !params.utilities_dir) { + + make_humann_db() + read_based(filtered_ch, + make_humann_db.out.chocophlan_dir, + make_humann_db.out.uniref_dir, + make_humann_db.out.metaphlan_db_dir, + make_humann_db.out.utilities_dir) + + software_versions_ch = Channel.empty() + make_humann_db.out.versions | mix(software_versions_ch) | set{software_versions_ch} + read_based.out.versions | mix(software_versions_ch) | set{software_versions_ch} + + }else{ + + read_based(filtered_ch, + params.chocophlan_dir, + params.uniref_dir, + params.metaphlan_db_dir, + params.utilities_dir) + + software_versions_ch = read_based.out.versions + } + + emit: + versions = software_versions_ch + +} + +// Workflow to perform assembly-based analysis +workflow run_assembly_based_analysis { + + take: + file_ch + filtered_ch + + + main: + software_versions_ch = Channel.empty() + + kofam_db = params.ko_db_dir + cat_db = params.cat_db + gtdbtk_db_dir = params.gtdbtk_db_dir + + // Run assembly based workflow + assembly_based(file_ch, filtered_ch, kofam_db, + cat_db, gtdbtk_db_dir, params.use_gtdbtk_scratch_location) + + + assembly_based.out.versions | mix(software_versions_ch) | set{software_versions_ch} + + + emit: + versions = software_versions_ch + +} + +// A function to delete white spaces from an input string and covert it to lower case +def deleteWS(string){ + + return string.replaceAll(/\s+/, '').toLowerCase() + +} + +// Main workflow +workflow { + + // Sanity check : Test input requirement + if (!params.accession && !params.input_file){ + + error("""${c_back_bright_red}INPUT ERROR! + Please supply either an accession (OSD or Genelab number) or an input CSV file + by passing either to the --accession or --input_file parameter, respectively. + ${c_reset}""") + } + + // Software Version Capturing - runsheet + software_versions_ch = Channel.empty() + // Parse file input + if(params.accession){ + + GET_RUNSHEET(params.accession) + GET_RUNSHEET.out.input_file + .splitCsv(header:true) + .set{file_ch} + + GET_RUNSHEET.out.version | mix(software_versions_ch) | set{software_versions_ch} + }else{ + + Channel.fromPath(params.input_file, checkIfExists: true) + .splitCsv(header:true) + .set{file_ch} + } + + + file_ch.map{ + row -> deleteWS(row.paired) == 'true' ? tuple( "${row.sample_id}", [file("${row.forward}", checkIfExists: true), file("${row.reverse}", checkIfExists: true)], deleteWS(row.paired)) : + tuple( "${row.sample_id}", [file("${row.forward}", checkIfExists: true)], deleteWS(row.paired)) + }.set{reads_ch} + + + + // Quality check and trim the input reads + raw_qc(Channel.of("raw"), params.multiqc_config,reads_ch) + BBDUK(reads_ch, params.adapters) + filtered_ch = BBDUK.out.reads + filtered_qc(Channel.of("filtered"), params.multiqc_config, filtered_ch) + + // Quality check software capturing + raw_qc.out.versions | mix(software_versions_ch) | set{software_versions_ch} + BBDUK.out.version | mix(software_versions_ch) | set{software_versions_ch} + filtered_qc.out.versions | mix(software_versions_ch) | set{software_versions_ch} + + // Run the analysis based on selection i.e, read-based, assembly-based or both + // it will run both by default + if(params.workflow == 'read-based'){ + + run_read_based_analysis(filtered_ch) + run_read_based_analysis.out.versions | mix(software_versions_ch) | set{software_versions_ch} + + }else if(params.workflow == 'assembly-based') { + + run_assembly_based_analysis(file_ch,filtered_ch) + run_assembly_based_analysis.out.versions | mix(software_versions_ch) | set{software_versions_ch} + + }else{ + + run_read_based_analysis(filtered_ch) + run_assembly_based_analysis(file_ch, filtered_ch) + + run_read_based_analysis.out.versions | mix(software_versions_ch) | set{software_versions_ch} + run_assembly_based_analysis.out.versions | mix(software_versions_ch) | set{software_versions_ch} + } + + + // Software Version Capturing - combining all captured sofware versions + nf_version = "Nextflow Version ".concat("${nextflow.version}") + nextflow_version_ch = Channel.value(nf_version) + workflow_version = "MGIllimina ".concat("${workflow.manifest.version}") + workflow_version_ch = Channel.value(workflow_version) + + // Write software versions to file + software_versions_ch | map { it.text.strip() } + | unique + | mix(nextflow_version_ch) + | mix(workflow_version_ch) + | collectFile(name: "${params.metadata_dir}/software_versions.txt", newLine: true, cache: false) + | set{final_software_versions_ch} + +} + + + +workflow.onComplete { + + println("${c_bright_green}Pipeline completed at: $workflow.complete") + println("""Execution status: ${ workflow.success ? 'OK' : "${c_back_bright_red}failed" }""") + log.info ( workflow.success ? "\nDone! Workflow completed without any error\n" : "Oops .. something went wrong${c_reset}" ) + + if ( workflow.success ) { + + println("FastQC outputs location: ${params.fastqc_out_dir}") + println("Read-based Analysis: ${params.read_based_dir}") + println("Assembly-based Analysis: ${params.assembly_based_dir}") + println("Software versions location: ${params.metadata_dir}") + println("Pipeline tracing/visualization files location: ../Resource_Usage${c_reset}") + println() + } + +} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/assembly.nf b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/assembly.nf new file mode 100644 index 000000000..7a4229b0d --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/assembly.nf @@ -0,0 +1,100 @@ +#!/usr/bin/env nextflow +nextflow.enable.dsl = 2 +//params.paired = false +//params.max_mem = 100e9 + +/**************************************************************************************** +************************** Sequence assembly and summary ******************************* +****************************************************************************************/ + +// This process handles running the assembly for each individual sample. +process ASSEMBLE { + + tag "Assembling ${sample_id}-s reads using megahit..." + + input: + tuple val(sample_id), path(reads), val(isPaired) + output: + tuple val(sample_id), path("${sample_id}_final.contigs.fa"), emit: contigs + path("${sample_id}-assembly.log"), emit: log + path("versions.txt"), emit: version + script: + """ + # Removing output directory if exists already but process still needs to be + # run (because there is no --force option to megahit i dont't think): + [ -d ${sample_id}-megahit-out/ ] && rm -rf ${sample_id}-megahit-out/ + + if [ ${isPaired} == true ]; then + + BASENAME_FORWARD=`basename -s '.gz' ${reads[0]}` + BASENAME_REVERSE=`basename -s '.gz' ${reads[1]}` + + zcat ${reads[0]} > \${BASENAME_FORWARD} + zcat ${reads[1]} > \${BASENAME_REVERSE} + + megahit -1 \${BASENAME_FORWARD} -2 \${BASENAME_REVERSE} \\ + -m ${params.max_mem} -t ${task.cpus} \\ + --min-contig-len 500 -o ${sample_id}-megahit-out > ${sample_id}-assembly.log 2>&1 + + else + + BASENAME=`basename -s '.gz' ${reads[0]}` + zcat ${reads[0]} > \${BASENAME} + megahit -r \${BASENAME} -m ${params.max_mem} -t ${task.cpus} \\ + --min-contig-len 500 -o ${sample_id}-megahit-out > ${sample_id}-assembly.log 2>&1 + fi + + mv ${sample_id}-megahit-out/final.contigs.fa ${sample_id}_final.contigs.fa + megahit -v > versions.txt + """ +} + + +process RENAME_HEADERS { + + tag "Renaming ${sample_id}-s assembly fasta file-s headers..." + label "bit" + label "assembly" + + input: + tuple val(sample_id), path(assembly) + output: + tuple val(sample_id), path("${sample_id}-assembly.fasta"), emit: contigs + path("versions.txt"), emit: version + path("Failed-assemblies.tsv"), optional: true, emit: failed_assembly + script: + """ + bit-rename-fasta-headers -i ${assembly} \\ + -w c_${sample_id} \\ + -o ${sample_id}-assembly.fasta + + # Checking the assembly produced anything (megahit can run, produce + # the output fasta, but it will be empty if no contigs were assembled) + if [ ! -s ${sample_id}-assembly.fasta ]; then + printf "${sample_id}\\tNo contigs assembled\\n" > Failed-assemblies.tsv + fi + bit-version |grep "Bioinformatics Tools"|sed -E 's/^\\s+//' > versions.txt + """ +} + + +// This process summarizes and reports general stats for all individual sample assemblies in one table. +process SUMMARIZE_ASSEMBLIES { + + tag "Generating a summary of all the assemblies..." + label "bit" + label "assembly" + + input: + path(assemblies) + output: + path("${params.additional_filename_prefix}assembly-summaries${params.assay_suffix}.tsv"), emit: summary + path("versions.txt"), emit: version + script: + """ + bit-summarize-assembly \\ + -o ${params.additional_filename_prefix}assembly-summaries${params.assay_suffix}.tsv \\ + ${assemblies} + bit-version |grep "Bioinformatics Tools"|sed -E 's/^\\s+//' > versions.txt + """ +} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/assembly_annotation.nf b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/assembly_annotation.nf new file mode 100644 index 000000000..d9dfae353 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/assembly_annotation.nf @@ -0,0 +1,203 @@ +#!/usr/bin/env nextflow +nextflow.enable.dsl = 2 +//params.cat_db = "/mnt/c/Users/olabi/Documents/bioinformatics/test/processing_info/ref-dbs/CAT_prepare_20210107/2021-01-07_CAT_database/" +//params.ko_db_dir = "/mnt/c/Users/olabi/Documents/bioinformatics/test/processing_info/ref-dbs/kofamscan_db/" +//params.block_size = 4 + +/**************************************************************************************** +************************** Sequence Assembly Annotation ******************************* +****************************************************************************************/ +// This process calls genes on each assembly file. +process CALL_GENES { + + tag "Predicting genes for ${sample_id}-s assembly" + label "call_genes" + + input: + tuple val(sample_id), path(assembly) + output: + // Amino acids, nucleotides and gff + tuple val(sample_id), path("${sample_id}-genes.faa"), path("${sample_id}-genes.fasta"), path("${sample_id}-genes.gff"), emit: genes + path("versions.txt"), emit: version + script: + """ + # Only running if assembly produced any contigs + if [ -s ${assembly} ]; then + + prodigal -q -c -p meta -a ${sample_id}-genes.faa \\ + -d ${sample_id}-genes.fasta \\ + -f gff -o ${sample_id}-genes.gff \\ + -i ${assembly} + else + + touch ${sample_id}-genes.faa ${sample_id}-genes.fasta ${sample_id}-genes.gff + printf "Gene-calling not performed because the assembly didn't produce anything.\\n" + + fi + prodigal -v 2>&1 | grep Prodigal > versions.txt + """ +} + +// Removing line-wraps using bit +process REMOVE_LINEWRAPS { + + tag "Remove line wraps in ${sample_id}-s nucleotide and amino acid file..." + label "call_genes" + label "bit" + + input: + tuple val(sample_id), path(aa), path(nt), path(gff) + + output: + tuple val(sample_id), path("${sample_id}-genes.faa"), path("${sample_id}-genes.fasta"), emit: genes + path("versions.txt"), emit: version + script: + """ + if [ -s ${aa} ] && [ -s ${nt} ]; then + # Removing line-wraps + bit-remove-wraps ${aa} > ${sample_id}-genes.faa.tmp 2> /dev/null && \\ + mv ${sample_id}-genes.faa.tmp ${sample_id}-genes.faa + + bit-remove-wraps ${nt} > ${sample_id}-genes.fasta.tmp 2> /dev/null && \\ + mv ${sample_id}-genes.fasta.tmp ${sample_id}-genes.fasta + else + + touch ${sample_id}-genes.faa ${sample_id}-genes.fasta + printf "Line wrapping not performed because gene-calling wasn't performed on ${sample_id}.\\n" + fi + bit-version |grep "Bioinformatics Tools"|sed -E 's/^\\s+//' > versions.txt + """ +} + + +// This process runs the gene-level (KO) functional annotation for each sample. +// KO annotatiuon of the predicted amino acids +process KO_ANNOTATION { + + tag "Running KO annotation of ${sample_id}-s predicted amino acids.." + //label "contig_annotation" + + input: + tuple val(sample_id), path(assembly), path(aa), path(nt) + path(ko_db_dir) + output: + tuple val(sample_id), path("${sample_id}-KO-tab.tmp"), emit: temp_table + path("versions.txt"), emit: version + script: + """ + # only running if assembly produced any contigs and genes were identified (they are required for this) + if [ -s ${assembly} ] && [ -s ${aa} ]; then + + exec_annotation -p ${ko_db_dir}/profiles/ \\ + -k ${ko_db_dir}/ko_list \\ + --cpu ${task.cpus} -f detail-tsv \\ + -o ${sample_id}-KO-tab.tmp --tmp-dir ${sample_id}-tmp-KO-dir \\ + --report-unannotated ${aa} + + else + + touch ${sample_id}-KO-tab.tmp + printf "Functional annotations not performed because the assembly didn't produce anything and/or no genes were identified.\\n" + + fi + exec_annotation -v > versions.txt + """ +} + + +process FILTER_KFAMSCAN { + + tag "Filtering ${sample_id}-s KO annotation results..." + label "bit" + label "contig_annotation" + + input: + tuple val(sample_id), path(KO_tab_tmp) + output: + tuple val(sample_id), path("${sample_id}-annotations.tsv"), emit: ko_annotation + path("versions.txt"), emit: version + script: + """ + if [ -s ${KO_tab_tmp} ]; then + + bit-filter-KOFamScan-results -i ${KO_tab_tmp} -o ${sample_id}-annotations.tsv + + else + + touch ${sample_id}-annotations.tsv + printf "Nothing to filter since functional annotation was not performed.\\n" + + fi + bit-version |grep "Bioinformatics Tools"|sed -E 's/^\\s+//' > versions.txt + """ + +} + +// This process runs the gene- and contig-level taxonomic classifications for each assembly. +process TAX_CLASSIFICATION { + + tag "Taxonomy classification of ${sample_id}-s " + label "contig_annotation" + + input: + tuple val(sample_id), path(assembly), path(aa), path(nt) + path(cat_db) + output: + // Gene and contig taxonomy + tuple val(sample_id), path("${sample_id}-gene-tax.tsv"), path("${sample_id}-contig-tax.tsv"), emit: taxonomy + path("versions.txt"), emit: version + script: + """ + # Only running if assembly produced any contigs and + # genes were identified (they are required for this) + if [ -s ${assembly} ] && [ -s ${aa} ]; then + + CAT contigs -d ${cat_db}/${params.cat_db_sub_dir} -t ${cat_db}/${params.cat_taxonomy_dir} \\ + -n ${task.cpus} -r 3 --top 4 \\ + --I_know_what_Im_doing -c ${assembly} \\ + -p ${aa} -o ${sample_id}-tax-out.tmp \\ + --no_stars --block_size ${params.block_size} \\ + --index_chunks 2 --force + + # Adding names to gene classifications + CAT add_names -i ${sample_id}-tax-out.tmp.ORF2LCA.txt \\ + -o ${sample_id}-gene-tax.tmp -t ${cat_db}/${params.cat_taxonomy_dir} \\ + --only_official --exclude_scores + + # Formatting gene classifications + bash format-gene-tax-classifications.sh \\ + ${sample_id}-gene-tax.tmp ${sample_id}-gene-tax.tsv + + # Adding names to contig classifications + CAT add_names -i ${sample_id}-tax-out.tmp.contig2classification.txt \\ + -o ${sample_id}-contig-tax.tmp -t ${cat_db}/${params.cat_taxonomy_dir} \\ + --only_official --exclude_scores + + # Formatting contig classifications + bash format-contig-tax-classifications.sh \\ + ${sample_id}-contig-tax.tmp ${sample_id}-contig-tax.tsv + + else + + touch ${sample_id}-gene-tax.tsv ${sample_id}-contig-tax.tsv + printf "Assembly-based taxonomic classification not performed because the assembly didn't produce anything and/or no genes were identified.\\n" + + fi + CAT --version | sed -E 's/(CAT v.+)\\s\\(.+/\\1/' > versions.txt + """ +} + +workflow annotate_assembly { + take: + assembly_ch + ko_db_dir + cat_db + + main: + CALL_GENES(assembly_ch) + genes_ch = CALL_GENES.out.genes | REMOVE_LINEWRAPS.out.genes + KO_ANNOTATION(assembly_ch.join(genes_ch) ko_db_dir) + KO_ANNOTATION.out.temp_table | FILTER_KFAMSCAN.out.ko_annotation + TAX_CLASSIFICATION(assembly_ch, genes_ch, cat_db) + +} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/assembly_based_processing.nf b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/assembly_based_processing.nf new file mode 100644 index 000000000..75ee18466 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/assembly_based_processing.nf @@ -0,0 +1,193 @@ +#!/usr/bin/env nextflow +nextflow.enable.dsl = 2 + +/**************************************************************************************** +*************************** Assembly-based processing workflow ************************* +****************************************************************************************/ + +// Assembly-based workflow +// Processes to create the required database(s) if not provided +include { SETUP_CAT_DB; SETUP_KOFAMSCAN_DB; SETUP_GTDBTK_DB; + SETUP_CHOCOPHLAN} from "./database_creation.nf" + +include { ASSEMBLE; RENAME_HEADERS; SUMMARIZE_ASSEMBLIES } from "./assembly.nf" +include { MAPPING; SAM_TO_BAM } from "./read_mapping.nf" +include { CALL_GENES; REMOVE_LINEWRAPS } from "./assembly_annotation.nf" +include { KO_ANNOTATION; FILTER_KFAMSCAN } from "./assembly_annotation.nf" +include { TAX_CLASSIFICATION } from "./assembly_annotation.nf" +include { GET_COV_AND_DET } from "./coverage.nf" +include { COMBINE_GENE_ANNOTS_TAX_AND_COVERAGE; MAKE_COMBINED_GENE_LEVEL_TABLES } from "./combine_contig_annotation.nf" +include { COMBINE_CONTIG_TAX_AND_COVERAGE; MAKE_COMBINED_CONTIG_TAX_TABLES } from "./combine_contig_annotation.nf" +include { METABAT_BINNING } from "./binning.nf" +include { summarize_bins } from "./summarize_bins.nf" +include { summarize_mags } from "./summarize_MAG.nf" +include { GENERATE_ASSEMBLY_PROCESSING_OVERVIEW_TABLE } from "./summarize_assembly-based_processing.nf" + +workflow assembly_based { + + take: + file_ch + filtered_ch + ko_db_dir + cat_db + gtdbtk_db_dir + use_gtdbtk_scratch_location + + main: + /***************************************************** + ************* Assembly-based analysis **************** + *****************************************************/ + + software_versions_ch = Channel.empty() + + // Assemble reads to contigs + ASSEMBLE(filtered_ch) + ASSEMBLE.out.contigs | RENAME_HEADERS + assembly_ch = RENAME_HEADERS.out.contigs + assemblies_ch = assembly_ch.map{ + sample_id, assembly -> file("${assembly}") + }.collect() + SUMMARIZE_ASSEMBLIES(assemblies_ch) + + // Write failed assemblies to a Failed assemblies file + failed_assemblies = RENAME_HEADERS.out.failed_assembly + failed_assemblies + .map{ it.text } + .collectFile(name: "${params.assemblies_dir}/Failed-assemblies${params.assay_suffix}.tsv", cache: false) + + // Map reads to assembly + MAPPING(assembly_ch.join(filtered_ch)) + MAPPING.out.sam | SAM_TO_BAM + read_mapping_ch = SAM_TO_BAM.out.bam + + // Annotate assembly + CALL_GENES(assembly_ch) + CALL_GENES.out.genes | REMOVE_LINEWRAPS + genes_ch = REMOVE_LINEWRAPS.out.genes + + if (ko_db_dir){ + + KO_ANNOTATION(assembly_ch.join(genes_ch), ko_db_dir) + KO_ANNOTATION.out.temp_table | FILTER_KFAMSCAN + annotations_ch = FILTER_KFAMSCAN.out.ko_annotation + + }else{ + + SETUP_KOFAMSCAN_DB() + SETUP_KOFAMSCAN_DB.out.version | mix(software_versions_ch) | set{software_versions_ch} + KO_ANNOTATION(assembly_ch.join(genes_ch), SETUP_KOFAMSCAN_DB.out.ko_db_dir) + KO_ANNOTATION.out.temp_table | FILTER_KFAMSCAN + annotations_ch = FILTER_KFAMSCAN.out.ko_annotation + + } + + if (cat_db){ + + TAX_CLASSIFICATION(assembly_ch.join(genes_ch), cat_db) + taxonomy_ch = TAX_CLASSIFICATION.out.taxonomy + + }else{ + + SETUP_CAT_DB(params.CAT_DB_LINK) + SETUP_CAT_DB.out.version | mix(software_versions_ch) | set{software_versions_ch} + TAX_CLASSIFICATION(assembly_ch.join(genes_ch), SETUP_CAT_DB.out.cat_db) + taxonomy_ch = TAX_CLASSIFICATION.out.taxonomy + } + + // Calculate gene coverage and depth + GET_COV_AND_DET(read_mapping_ch + .join(assembly_ch) + .join(genes_ch)) + coverage_ch = GET_COV_AND_DET.out.coverages + + // Combine contig annotations + tax_and_cov_ch = COMBINE_GENE_ANNOTS_TAX_AND_COVERAGE(coverage_ch + .join(annotations_ch) + .join(taxonomy_ch) + .join(genes_ch) + .join(assembly_ch)) + + gene_coverage_annotation_and_tax_files_ch = tax_and_cov_ch.map{ + sample_id, coverage -> file("${coverage}") + }.collect() + + MAKE_COMBINED_GENE_LEVEL_TABLES(gene_coverage_annotation_and_tax_files_ch) + + combined_cov_ch = COMBINE_CONTIG_TAX_AND_COVERAGE(coverage_ch + .join(taxonomy_ch) + .join(genes_ch) + .join(assembly_ch)) + + MAKE_COMBINED_CONTIG_TAX_TABLES(combined_cov_ch.map{ + sample_id, coverage -> file("${coverage}") + }.collect()) + + // Assembly binning + METABAT_BINNING(assembly_ch.join(read_mapping_ch)) + binning_ch = METABAT_BINNING.out.bins + binning_ch | summarize_bins + depth_ch = METABAT_BINNING.out.depth + metabat_assembly_depth_files_ch = depth_ch.map{ + sample_id, depth -> file("${depth}") + }.collect() + bins_ch = binning_ch.map{ + sample_id, bins -> bins instanceof List ? bins.each{it}: bins + }.flatten().collect() + + + // Check Bins and Summarize MAGs + if(gtdbtk_db_dir){ + summarize_mags(summarize_bins.out.bins_checkm_results, + bins_ch, + gtdbtk_db_dir, use_gtdbtk_scratch_location, + gene_coverage_annotation_and_tax_files_ch) + }else{ + SETUP_GTDBTK_DB(params.GTDBTK_LINK) + SETUP_GTDBTK_DB.out.version | mix(software_versions_ch) | set{software_versions_ch} + summarize_mags(summarize_bins.out.bins_checkm_results, + bins_ch, + SETUP_GTDBTK_DB.out.gtdbtk_db_dir, use_gtdbtk_scratch_location, + gene_coverage_annotation_and_tax_files_ch) + } + + // Get the predicted amino acids for all the samples + genes_aa_ch = genes_ch.map{sample_id, aa, nt -> file("${aa}")}.collect() + + // Generating a file with sample ids on a new line + file_ch.map{row -> "${row.sample_id}"} + .collectFile(name: "${launchDir}/unique-sample-IDs.txt", newLine: true) + .set{sample_ids_ch} + + + bam_files = read_mapping_ch.map{sample_id, bam -> file("${bam}")}.collect() + // Summarize Assembly-based analysis + GENERATE_ASSEMBLY_PROCESSING_OVERVIEW_TABLE(sample_ids_ch, summarize_mags.out.MAGs_overview, + summarize_mags.out.MAGs_dir, assemblies_ch, + genes_aa_ch, + metabat_assembly_depth_files_ch, + bins_ch, + bam_files) + + // Capture software versions + ASSEMBLE.out.version | mix(software_versions_ch) | set{software_versions_ch} + RENAME_HEADERS.out.version | mix(software_versions_ch) | set{software_versions_ch} + SUMMARIZE_ASSEMBLIES.out.version | mix(software_versions_ch) | set{software_versions_ch} + MAPPING.out.version | mix(software_versions_ch) | set{software_versions_ch} + SAM_TO_BAM.out.version | mix(software_versions_ch) | set{software_versions_ch} + CALL_GENES.out.version | mix(software_versions_ch) | set{software_versions_ch} + REMOVE_LINEWRAPS.out.version | mix(software_versions_ch) | set{software_versions_ch} + KO_ANNOTATION.out.version | mix(software_versions_ch) | set{software_versions_ch} + FILTER_KFAMSCAN.out.version | mix(software_versions_ch) | set{software_versions_ch} + TAX_CLASSIFICATION.out.version | mix(software_versions_ch) | set{software_versions_ch} + GET_COV_AND_DET.out.version | mix(software_versions_ch) | set{software_versions_ch} + MAKE_COMBINED_GENE_LEVEL_TABLES.out.version | mix(software_versions_ch) | set{software_versions_ch} + MAKE_COMBINED_CONTIG_TAX_TABLES.out.version | mix(software_versions_ch) | set{software_versions_ch} + METABAT_BINNING.out.version | mix(software_versions_ch) | set{software_versions_ch} + summarize_bins.out.versions | mix(software_versions_ch) | set{software_versions_ch} + summarize_mags.out.versions | mix(software_versions_ch) | set{software_versions_ch} + + + emit: + versions = software_versions_ch + +} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/binning.nf b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/binning.nf new file mode 100644 index 000000000..c851b3dd1 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/binning.nf @@ -0,0 +1,87 @@ +#!/usr/bin/env nextflow +nextflow.enable.dsl = 2 + +/**************************************************************************************** +********************* Assembly binning ************************************************* +****************************************************************************************/ + + + +// This process runs metabat2 for binning contigs. +process METABAT_BINNING { + + tag "Binning ${sample_id}-s contigs with metabat2..." + + input: + tuple val(sample_id), path(assembly), path(bam) + output: + tuple val(sample_id), path("${sample_id}-metabat-assembly-depth.tsv"), emit: depth + tuple val(sample_id), path("${sample_id}-bin*"), emit: bins, optional: true + path("versions.txt"), emit: version + script: + """ + # Only running if the assembly produced anything + if [ -s ${assembly} ]; then + + jgi_summarize_bam_contig_depths \\ + --outputDepth ${sample_id}-metabat-assembly-depth.tsv \\ + --percentIdentity 97 \\ + --minContigLength 1000 \\ + --minContigDepth 1.0 \\ + --referenceFasta ${assembly} ${bam} + + # only running if there are contigs with coverage + # information in the coverage file we just generated + if [ `wc -l ${sample_id}-metabat-assembly-depth.tsv | sed 's/^ *//' | cut -f 1 -d " "` -gt 1 ]; then + + metabat2 \\ + --inFile ${assembly} \\ + --outFile ${sample_id}-bin \\ + --abdFile ${sample_id}-metabat-assembly-depth.tsv \\ + -t ${task.cpus} + + else + + printf "\\n\\nThere was no coverage info generated in ${sample_id}-metabat-assembly-depth.tsv, so no binning with metabat was performed.\\n\\n" + + fi + + # changing extensions from .fa to .fasta to match nt fasta extension elsewhere in GeneLab + find . -name '${sample_id}*.fa' > ${sample_id}-bin-files.tmp + + if [ -s ${sample_id}-bin-files.tmp ]; then + paste -d " " <( sed 's/^/mv /' ${sample_id}-bin-files.tmp ) \\ + <( sed 's/.fa/.fasta/' ${sample_id}-bin-files.tmp ) \\ + > ${sample_id}-rename.tmp + bash ${sample_id}-rename.tmp + fi + + rm -rf ${sample_id}-bin-files.tmp ${sample_id}-rename.tmp + + else + + touch ${sample_id}-metabat-assembly-depth.tsv + printf "Binning not performed because the assembly didn't produce anything.\\n" + fi + echo metabat2 \$(metabat2 --help 2>&1 | head -n 2 | tail -n 1| sed 's/.*\\:\\([0-9]*\\.[0-9]*\\).*/\\1/') > versions.txt + """ +} + + + +workflow binning { + + take: + assembly_ch + read_mapping_ch + + + main: + binning_ch = METABAT_BINNING(assembly_ch.join(read_mapping_ch)) + + + emit: + binning_results = binning_ch.out.bins + +} + diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/combine_contig_annotation.nf b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/combine_contig_annotation.nf new file mode 100644 index 000000000..9d7893c07 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/combine_contig_annotation.nf @@ -0,0 +1,206 @@ +#!/usr/bin/env nextflow +nextflow.enable.dsl = 2 + + +/**************************************************************************************** +************************** Combine Contig Annotation *********************************** +****************************************************************************************/ + + +/* +This process combines the gene-level functional annotations, taxonomic classifications, + and coverage information for each individual sample. +*/ +process COMBINE_GENE_ANNOTS_TAX_AND_COVERAGE { + + tag "Combining gene and taxonomy annotations for ${sample_id}" + label "bit" + label "contig_annotation" + + input: + tuple val(sample_id), path(gene_coverages), path(contig_coverages), + path(annotations), path(gene_tax), path(contig_tax), + path(aa), path(nt), path(assembly) + output: + tuple val(sample_id), path("${sample_id}-gene-coverage-annotation-and-tax.tsv") + script: + """ + # Only running if the assembly produced anything + # and genes were identified (they are required for this) + if [ -s ${assembly} ] && [ -s ${aa} ]; then + + paste <( tail -n +2 ${gene_coverages} | \\ + sort -V -k 1 ) <( tail -n +2 ${annotations} | \\ + sort -V -k 1 | cut -f 2- ) <( tail -n +2 ${gene_tax} | \\ + sort -V -k 1 | \\ + cut -f 2- ) > ${sample_id}-gene.tmp + + paste <( head -n 1 ${gene_coverages} ) \\ + <( head -n 1 ${annotations} | \\ + cut -f 2- ) <( head -n 1 ${gene_tax} | \\ + cut -f 2- ) > ${sample_id}-gene-header.tmp + + cat ${sample_id}-gene-header.tmp ${sample_id}-gene.tmp \\ + > ${sample_id}-gene-coverage-annotation-and-tax.tsv + + rm -rf ${sample_id}-gene.tmp ${sample_id}-gene-header.tmp + + + else + + printf "gene_ID\\tcoverage\\tKO_ID\\tKO_function\\ttaxid\\tdomain\\tphylum\\tclass\\torder\\tfamily\\tgenus\\tspecies\\n" \\ + > ${sample_id}-gene-coverage-annotation-and-tax.tsv + + fi + """ +} + + +process MAKE_COMBINED_GENE_LEVEL_TABLES { + + tag "Combining all gene level annotations...." + label "bit" + label "combine_outputs" + + input: + path(gene_coverage_annotation_and_tax_files) + output: + path("${params.additional_filename_prefix}Combined-gene-level-KO-function-coverages${params.assay_suffix}.tsv"), emit: raw_function_coverages + path("${params.additional_filename_prefix}Combined-gene-level-KO-function-coverages-CPM${params.assay_suffix}.tsv"), emit: norm_function_coverages + path("${params.additional_filename_prefix}Combined-gene-level-taxonomy-coverages${params.assay_suffix}.tsv"), emit: raw_taxonomy_coverages + path("${params.additional_filename_prefix}Combined-gene-level-taxonomy-coverages-CPM${params.assay_suffix}.tsv"), emit: norm_taxonomy_coverages + path("versions.txt"), emit: version + script: + """ + bit-GL-combine-KO-and-tax-tables ${gene_coverage_annotation_and_tax_files} -o ${params.additional_filename_prefix}Combined + + # Renaming to have GL assay-specific suffix + mv "${params.additional_filename_prefix}Combined-gene-level-KO-function-coverages.tsv" \\ + "${params.additional_filename_prefix}Combined-gene-level-KO-function-coverages${params.assay_suffix}.tsv" + + mv "${params.additional_filename_prefix}Combined-gene-level-KO-function-coverages-CPM.tsv" \\ + "${params.additional_filename_prefix}Combined-gene-level-KO-function-coverages-CPM${params.assay_suffix}.tsv" + + mv "${params.additional_filename_prefix}Combined-gene-level-taxonomy-coverages.tsv" \\ + "${params.additional_filename_prefix}Combined-gene-level-taxonomy-coverages${params.assay_suffix}.tsv" + + mv "${params.additional_filename_prefix}Combined-gene-level-taxonomy-coverages-CPM.tsv" \\ + "${params.additional_filename_prefix}Combined-gene-level-taxonomy-coverages-CPM${params.assay_suffix}.tsv" + bit-version |grep "Bioinformatics Tools"|sed -E 's/^\\s+//' > versions.txt + """ +} + +// This process combines the contig-level taxonomic and +// coverage information for each individual sample. +process COMBINE_CONTIG_TAX_AND_COVERAGE { + + tag "Combining taxonomy and coverage for ${sample_id}...." + label "bit" + label "contig_annotation" + + input: + tuple val(sample_id), path(gene_coverages), path(contig_coverages), + path(gene_tax), path(contig_tax), + path(aa), path(nt), path(assembly) + output: + tuple val(sample_id), path("${sample_id}-contig-coverage-and-tax.tsv") + script: + """ + # Only running if the assembly produced anything + if [ -s ${assembly} ]; then + + # If there were no genes called, there is no contig-level taxonomy, so dealing with that here + if [ -s ${aa} ]; then + + paste <( tail -n +2 ${contig_coverages} | \\ + sort -V -k 1 ) <( tail -n +2 ${contig_tax} | \\ + sort -V -k 1 | cut -f 2- ) > ${sample_id}-contig.tmp + paste <( head -n 1 ${contig_coverages} ) \\ + <( head -n 1 ${contig_tax} | cut -f 2- ) \\ + > ${sample_id}-contig-header.tmp + + cat ${sample_id}-contig-header.tmp ${sample_id}-contig.tmp \\ + > ${sample_id}-contig-coverage-and-tax.tsv + + rm -rf ${sample_id}-contig.tmp ${sample_id}-contig-header.tmp + + else + + paste <( tail -n +2 ${contig_coverages} | sort -V -k 1 ) > ${sample_id}-contig-p1.tmp + + sed 's/.*/NA/g' ${sample_id}-contig-p1.tmp > ${sample_id}-tax-col.tmp + + paste ${sample_id}-contig-p1.tmp ${sample_id}-tax-col.tmp ${sample_id}-tax-col.tmp \\ + ${sample_id}-tax-col.tmp ${sample_id}-tax-col.tmp ${sample_id}-tax-col.tmp \\ + ${sample_id}-tax-col.tmp ${sample_id}-tax-col.tmp ${sample_id}-tax-col.tmp \\ + > ${sample_id}-contig.tmp + + cat <( printf "contig_ID\\tcoverage\\ttaxid\\tdomain\\tphylum\\tclass\\torder\\tfamily\\tgenus\\tspecies\\n" ) \\ + ${sample_id}-contig.tmp > ${sample_id}-contig-coverage-and-tax.tsv + rm -rf ${sample_id}-contig-p1.tmp ${sample_id}-tax-col.tmp ${sample_id}-contig.tmp + + fi + + else + + printf "contig_ID\\tcoverage\\ttaxid\\tdomain\\tphylum\\tclass\\torder\\tfamily\\tgenus\\tspecies\\n" \\ + > ${sample_id}-contig-coverage-and-tax.tsv + + fi + """ +} + +process MAKE_COMBINED_CONTIG_TAX_TABLES { + + tag "Making a summary contig taxonomy table...." + label "bit" + label "combine_outputs" + + input: + path(contig_coverage_and_tax_files) + output: + path("${params.additional_filename_prefix}Combined-contig-level-taxonomy-coverages${params.assay_suffix}.tsv"), emit: raw_taxonomy + path("${params.additional_filename_prefix}Combined-contig-level-taxonomy-coverages-CPM${params.assay_suffix}.tsv"), emit: norm_taxonomy + path("versions.txt"), emit: version + script: + """ + bit-GL-combine-contig-tax-tables ${contig_coverage_and_tax_files} -o ${params.additional_filename_prefix}Combined + + # Renaming to have GL assay-specific suffix + mv "${params.additional_filename_prefix}Combined-contig-level-taxonomy-coverages.tsv" \\ + "${params.additional_filename_prefix}Combined-contig-level-taxonomy-coverages${params.assay_suffix}.tsv" + + mv "${params.additional_filename_prefix}Combined-contig-level-taxonomy-coverages-CPM.tsv" \\ + "${params.additional_filename_prefix}Combined-contig-level-taxonomy-coverages-CPM${params.assay_suffix}.tsv" + bit-version |grep "Bioinformatics Tools"|sed -E 's/^\\s+//' > versions.txt + """ +} + + + + +workflow { + take: + coverages_ch + annotations_ch + taxonomy_ch + gene_call_ch + assembly_ch + + main: + tax_and_cov_ch = COMBINE_GENE_ANNOTS_TAX_AND_COVERAGE(coverages_ch + .join(annotations_ch) + .join(taxonomy_ch) + .join(gene_call_ch) + .join(assembly_ch)) + + MAKE_COMBINED_GENE_LEVEL_TABLES(tax_and_cov_ch.map{sample_id, coverage -> file("${coverage}")}.collect()) + + combined_cov_ch = COMBINE_CONTIG_TAX_AND_COVERAGE(coverages_ch + .join(taxonomy_ch) + .join(gene_call_ch) + .join(assembly_ch)) + + MAKE_COMBINED_CONTIG_TAX_TABLES(combined_cov_ch.map{sample_id, coverage -> file("${coverage}")}.collect()) +} + diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/coverage.nf b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/coverage.nf new file mode 100644 index 000000000..9bfd9e62b --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/coverage.nf @@ -0,0 +1,81 @@ +#!/usr/bin/env nextflow +nextflow.enable.dsl = 2 +//params.pileup_mem = "5g" + +/* + This process pulls out coverage and detection information for each sample, gene-level and contig-level, + and filters the gene-level coverage information based on requiring at least 50% detection. +*/ + +process GET_COV_AND_DET { + + tag "Calculating gene and contig coverage for ${sample_id}..." + + input: + tuple val(sample_id), path(bam), path(assembly), path(aa), path(nt) + output: + // Gene_covs and contig_covs + tuple val(sample_id), path("${sample_id}-gene-coverages.tsv"), path("${sample_id}-contig-coverages.tsv"), emit: coverages + path("versions.txt"), emit: version + script: + """ + # Only running if the assembly produced anything + if [ -s ${assembly} ]; then + + # Only running on genes also if genes were identified + if [ -s ${nt} ]; then + + pileup.sh -Xmx${params.pileup_mem} -in ${bam} \\ + fastaorf=${nt} outorf=${sample_id}-gene-cov-and-det.tmp \\ + out=${sample_id}-contig-cov-and-det.tmp + + # Filtering coverages based on detection + # Genes + grep -v "#" ${sample_id}-gene-cov-and-det.tmp | \\ + awk -F \$'\\t' ' BEGIN {OFS=FS} { if ( \$10 <= 0.5 ) \$4 = 0 } { print \$1,\$4 } ' \\ + > ${sample_id}-gene-cov.tmp + + cat <( printf "gene_ID\\tcoverage\\n" ) ${sample_id}-gene-cov.tmp > ${sample_id}-gene-coverages.tsv + + # Contigs + grep -v "#" ${sample_id}-contig-cov-and-det.tmp | \\ + awk -F \$'\\t' ' BEGIN {OFS=FS} { if ( \$5 <= 50 ) \$2 = 0 } { print \$1,\$2 } ' \\ + > ${sample_id}-contig-cov.tmp + + cat <( printf "contig_ID\\tcoverage\\n" ) ${sample_id}-contig-cov.tmp > ${sample_id}-contig-coverages.tsv + + # Removing intermediate files + rm ${sample_id}-gene-cov-and-det.tmp ${sample_id}-contig-cov-and-det.tmp \\ + ${sample_id}-gene-cov.tmp ${sample_id}-contig-cov.tmp + + else + + pileup.sh -in ${bam} out=${sample_id}-contig-cov-and-det.tmp + + # Filtering coverages based on detection + # Contigs + grep -v "#" ${sample_id}-contig-cov-and-det.tmp | \\ + awk -F \$'\\t' ' BEGIN {OFS=FS} { if ( \$5 <= 50 ) \$2 = 0 } { print \$1,\$2 } ' \\ + > ${sample_id}-contig-cov.tmp + cat <( printf "contig_ID\\tcoverage\\n" ) ${sample_id}-contig-cov.tmp > ${sample_id}-contig-coverages.tsv + + # Writing out empty genes coverage file + printf "gene_ID\\tcoverage\\n" > ${sample_id}-gene-coverages.tsv + printf "\\n\\nGene-level coverage info not recovered because the assembly didn't have any genes identified.\\n" + + # Removing intermediate files + rm ${sample_id}-contig-cov-and-det.tmp ${sample_id}-contig-cov.tmp + + fi + + else + + printf "gene_ID\\tcoverage\\n" > ${sample_id}-gene-coverages.tsv + printf "contig_ID\\tcoverage\\n" > ${sample_id}-contig-coverages.tsv + printf "Coverage info not recovered because the assembly didn't produce anything.\\n" + + fi + VERSION=`bbversion.sh` + echo "bbtools \${VERSION}" > versions.txt + """ +} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/create_runsheet.nf b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/create_runsheet.nf new file mode 100644 index 000000000..b1eb710e9 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/create_runsheet.nf @@ -0,0 +1,60 @@ +#!/usr/bin/env nextflow +nextflow.enable.dsl = 2 + +//params.accession = "OSD-574" +//params.RawFilePattern = null // Pattern of files on OSDR for the OSD accession you want to process + +process GET_RUNSHEET { + + beforeScript "chmod +x ${projectDir}/bin/create_runsheet.sh" + tag "Downloading raw fastq files and runsheet for ${accession}..." + + input: + val(accession) + output: + path("a_*metagenomic*.txt"), emit: assay_TABLE + path("*.zip"), emit: zip + path("GLfile.csv"), emit: input_file + path("versions.txt"), emit: version + script: + """ + # Download ISA zip file for the GLDS/OSD accession then unzip it + GL-download-GLDS-data -g ${accession} -p ISA -f && unzip *-ISA.zip + + if [ ${params.RawFilePattern} == null ];then + + # Attempt to download the sequences using the assay table, if that fails then + # attempt retrieving all fastq.gz files + GL-download-GLDS-data -f -g ${accession} -a a_*metagenomic*.txt -o Raw_Sequence_Data || \\ + GL-download-GLDS-data -f -g ${accession} -p ".fastq.gz" -o Raw_Sequence_Data + + else + + + GL-download-GLDS-data -f -g ${accession} -p ${params.RawFilePattern} -o Raw_Sequence_Data + + fi + + # Handle case where URLs contain the "+" sign and replaces it with %2B + if grep -q '+' *wanted-file-download-commands.sh;then + grep '+' *wanted-file-download-commands.sh | \\ + sort -u | \\ + awk '{gsub(/\\+/,"%2B", \$NF);print}' \\ + > plus_containing_${accession}-wanted-file-download-commands.sh + cat plus_containing_${accession}-wanted-file-download-commands.sh | parallel -j $task.cpus + fi + + # Create runsheet from the assay table + create_runsheet.sh a_*metagenomic*.txt > GLfile.csv + GL-version | grep "GeneLab utils"| sed -E 's/^\\s+//' > versions.txt + """ +} + + +workflow { + + GET_RUNSHEET(params.accession) + file_ch = GET_RUNSHEET.out.input_file + .splitCsv(header:true) + +} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/database_creation.nf b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/database_creation.nf new file mode 100644 index 000000000..5ee6cd91a --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/database_creation.nf @@ -0,0 +1,283 @@ +#!/usr/bin/env nextflow +nextflow.enable.dsl = 2 + +//params.CAT_DL_LINK = "https://tbb.bio.uu.nl/bastiaan/CAT_prepare/CAT_prepare_20210107.tar.gz" + +/**************************************************************************************** +*************************** Metagenomics databases set-up ****************************** +****************************************************************************************/ + +// This process download CAT reference database. +process SETUP_CAT_DB { + + tag "Downloading and setting up contig annotation tool-s (CAT) database..." + label "db_setup" + + input: + val(CAT_DB_LINK) + output: + path("CAT_prepare_20210107/"), emit: cat_db + path("CAT_prepare_20210107/CAT_DB_SETUP"), emit: completion_indicator + path("versions.txt"), emit: version + script: + """ + printf "### Setting up CAT's reference database ###\\n\\n" + printf " Downloading reference db:\\n\\n" + curl -L -C - -o CAT_prepare_20210107.tar.gz ${CAT_DB_LINK} + + printf "\\n\\n Extracting reference db:\\n\\n" + tar -xvzf CAT_prepare_20210107.tar.gz + + rm CAT_prepare_20210107.tar.gz CAT_prepare_20210107/2021-01-07_CAT_database/2021-01-07.nr.gz + touch CAT_prepare_20210107/CAT_DB_SETUP + curl --version |head -n 1 | sed -E 's/(curl\\s.+)\\s\\(.+/\\1/' > versions.txt + printf "### Set up completed successfully ###\\n\\n" + """ +} + +// This process downloads KOFamScan db (minimally currently). +process SETUP_KOFAMSCAN_DB { + + tag "Downloading and setting up kofam scan-s database..." + label "db_setup" + + output: + path("kofamscan_db/"), emit: ko_db_dir + path("kofamscan_db/KO_DB_SETUP"), emit: completion_indicator + path("versions.txt"), emit: version + script: + """ + printf "### Setting up KOFamScan reference database ###\\n\\n" + + # Using https instead of ftp for those whose systems don't have access to the ftp servers + + printf "\\n Downloading ko_list file:\\n\\n" + + if ! curl -L -C - --connect-timeout 15 -o ko_list.gz ftp://ftp.genome.jp/pub/db/kofam/ko_list.gz + then + printf "\\n\\n Downloading via http since ftp seemed to fail making the connection:\\n\\n" + curl -L -C - -o ko_list.gz https://www.genome.jp/ftp/db/kofam/ko_list.gz + fi + + printf "\\n\\n Downloading profiles.tar.gz file:\\n\\n" + + + if ! curl -L -C - --connect-timeout 15 -o profiles.tar.gz ftp://ftp.genome.jp/pub/db/kofam/profiles.tar.gz + then + printf "\\n\\n Downloading via http since ftp seemed to fail making the connection:\\n\\n" + curl -L -C - -o profiles.tar.gz https://www.genome.jp/ftp/db/kofam/profiles.tar.gz + fi + + [ -d kofamscan_db/ ] || mkdir kofamscan_db/ + printf "\\n\\n Decompressing profiles.tar.gz file:\\n\\n" + tar -xzf profiles.tar.gz -C kofamscan_db/ + rm profiles.tar.gz + + gunzip ko_list.gz && \\ + mv ko_list kofamscan_db/ && \\ + touch kofamscan_db/KO_DB_SETUP + curl --version |head -n 1 | sed -E 's/(curl\\s.+)\\s\\(.+/\\1/' > versions.txt + printf "### Set up completed successfully ###\\n\\n" + """ +} + +// This process downloads the gtdb-tk db (minimally currently) +process SETUP_GTDBTK_DB { + + tag "Downloading and setting up genome taxonomy database toolkit-s (GTDBTK) database..." + label "db_setup" + + input: + val(GTDBTK_URL) + output: + path("GTDB-tk-ref-db/"), emit: gtdbtk_db_dir + path("GTDB-tk-ref-db/SETUP_GTDBTK_DB_SETUP"), emit: completion_indicator + path("versions.txt"), emit: version + script: + """ + [ -d GTDB-tk-ref-db/ ] || mkdir -p GTDB-tk-ref-db/ + + # But still needs to be set for this particular session that is downloading and setting up the db + export GTDBTK_DATA_PATH=GTDB-tk-ref-db/ + # Downloading + download-GTDBTK-db.sh ${GTDBTK_URL} && touch GTDB-tk-ref-db/SETUP_GTDBTK_DB_SETUP + gtdbtk -h |grep "GTDB-Tk" | sed -E 's/.+\\s+(GTDB-Tk v.+)\\s+.+/\\1/' > versions.txt + printf "### Set up completed successfully ###\\n\\n" + """ +} + +// The processes below download the databases required by humann3. +process SETUP_CHOCOPHLAN { + + tag "Downloading and setting up Humann-s chocoplan nucleotide database..." + label "humann_setup" + label "db_setup" + + output: + path("humann3-db/chocophlan"), emit: chocophlan_dir + path("humann3-db/CHOCOPHLAN_DB_SETUP"), emit: completion_indicator + path("versions.txt"), emit: version + script: + """ + [ -d humann3-db/ ] || mkdir -p humann3-db/ + printf "### Setting up humann3 reference databases ###\\n\\n" + + if [ ! -f humann3-db/CHOCOPHLAN_DB_SETUP ]; then + printf " Downloading full chocophlan db:\\n\\n" + # No need to update locations since I pass them as arguaments to the script + humann3_databases --update-config no --download chocophlan full humann3-db/ && \\ + touch humann3-db/CHOCOPHLAN_DB_SETUP + humann3 --version > versions.txt + printf "### Set up completed successfully ###\\n\\n" + fi + + """ +} + + +process SETUP_UNIREF { + + tag "Downloading and setting up Humann-s uniref protein database..." + label "humann_setup" + label "db_setup" + + output: + path("humann3-db/uniref/"), emit: uniref_dir + path("humann3-db/UNIREF_DB_SETUP"), emit: completion_indicator + path("versions.txt"), emit: version + script: + """ + [ -d humann3-db/ ] || mkdir -p humann3-db/ + printf "### Setting up humann3's uniref database ###\\n\\n" + if [ ! -f humann3-db/UNIREF_DB_SETUP ];then + printf "\\n\\n Downloading uniref90_ec_filtered_diamond db:\\n\\n" + # No need to update locations since I pass them as arguaments to the script + humann3_databases --update-config no --download uniref uniref90_ec_filtered_diamond humann3-db/ && \\ + touch humann3-db/UNIREF_DB_SETUP + humann3 --version > versions.txt + printf "### Set up completed successfully ###\\n\\n" + fi + """ +} + +process SETUP_UTILITY_MAPPING { + + tag "Downloading and setting up Humann-s utilities mapping database..." + label "humann_setup" + label "db_setup" + + output: + path("humann3-db/utility_mapping/"), emit: utilities_dir + path("humann3-db/UTILITY_MAPPING_SETUP"), emit: completion_indicator + path("versions.txt"), emit: version + script: + """ + [ -d humann3-db/ ] || mkdir -p humann3-db/ + printf "### Setting up humann3's utilities mapping database ###\\n\\n" + if [ ! -f humann3-db/UTILITY_MAPPING_SETUP ];then + printf "\\n\\n Downloading full utility_mapping db:\\n\\n" + + # Containers are read only but conda environments can be modified + if [ ${params.use_conda} == 'true'];then + + humann3_databases --update-config yes --download utility_mapping full humann3-db/ && \\ + touch humann3-db/UTILITY_MAPPING_SETUP + + else + + humann3_databases --update-config no --download utility_mapping full humann3-db/ && \\ + touch humann3-db/UTILITY_MAPPING_SETUP + + fi + humann3 --version > versions.txt + printf "### Set up completed successfully ###\\n\\n" + fi + """ +} + + +process SETUP_METAPHLAN { + tag "Downloading and setting up Humann-s utilities mapping database..." + label "humann_setup" + label "db_setup" + + output: + path("metaphlan4-db/"), emit: metaphlan_db_dir + path("metaphlan4-db/METAPHLAN4_DB_SETUP"), emit: completion_indicator + path("versions.txt"), emit: version + script: + """ + [ -d metaphlan4-db/ ] || mkdir -p metaphlan4-db/ + printf "### Setting up metaphlan's reference database ###\\n\\n" + + if [ ! -f metaphlan4-db/METAPHLAN4_DB_SETUP ];then + printf "\\n\\n Downloading metaphlan db:\\n\\n" + metaphlan --install --bowtie2db metaphlan4-db/ && \\ + touch metaphlan4-db/METAPHLAN4_DB_SETUP + metaphlan --version > versions.txt + printf "### Set up completed successfully ###\\n\\n" + fi + """ +} + + +workflow make_humann_db { + + main: + SETUP_CHOCOPHLAN() + SETUP_UNIREF() + SETUP_UTILITY_MAPPING() + SETUP_METAPHLAN() + + software_versions_ch = Channel.empty() + SETUP_CHOCOPHLAN.out.version | mix(software_versions_ch) | set{software_versions_ch} + SETUP_UNIREF.out.version | mix(software_versions_ch) | set{software_versions_ch} + SETUP_METAPHLAN.out.version | mix(software_versions_ch) | set{software_versions_ch} + SETUP_UTILITY_MAPPING.out.version | mix(software_versions_ch) | set{software_versions_ch} + + emit: + chocophlan_dir = SETUP_CHOCOPHLAN.out.chocophlan_dir + uniref_dir = SETUP_UNIREF.out.uniref_dir + metaphlan_db_dir = SETUP_METAPHLAN.out.metaphlan_db_dir + utilities_dir = SETUP_UTILITY_MAPPING.out.utilities_dir + versions = software_versions_ch + +} + +workflow make_databases { + + take: + CAT_DB_LINK + GTDBTK_URL + + main: + SETUP_CAT_DB(CAT_DB_LINK) + SETUP_KOFAMSCAN_DB() + SETUP_GTDBTK_DB(GTDBTK_URL) + make_humann_db() + + software_versions_ch = Channel.empty() + SETUP_CAT_DB.out.version | mix(software_versions_ch) | set{software_versions_ch} + SETUP_KOFAMSCAN_DB.out.version | mix(software_versions_ch) | set{software_versions_ch} + SETUP_GTDBTK_DB.out.version | mix(software_versions_ch) | set{software_versions_ch} + make_humann_db.out.versions | mix(software_versions_ch) | set{software_versions_ch} + + + + emit: + cat_db = SETUP_CAT_DB.out.cat_db + kofam_db = SETUP_KOFAMSCAN_DB.out.ko_db_dir + gtdbtk_db_dir = SETUP_GTDBTK_DB.out.gtdbtk_db_dir + chocophlan_dir = make_humann_db.out.chocophlan_dir + uniref_dir = make_humann_db.out.uniref_dir + metaphlan_db_dir = make_humann_db.out.metaphlan_db_dir + utilities_dir = make_humann_db.out.utilities_dir + versions = software_versions_ch + + } + + + +workflow { + make_databases(Channel.of(params.CAT_DB_LINK), Channel.of(params.GTDBTK_LINK)) +} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/genelab.nf b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/genelab.nf new file mode 100644 index 000000000..9cd52ec65 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/genelab.nf @@ -0,0 +1,283 @@ +#!/usr/bin/env nextflow +nextflow.enable.dsl = 2 + +process CLEAN_FASTQC_PATHS { + tag "Purging genelab paths from MultiQC zip files in ${params.FastQC_Outputs}" + input: + path(FastQC_Outputs_dir) + output: + path("${OUT_DIR}"), emit: clean_dir + script: + OUT_DIR = "${FastQC_Outputs_dir.baseName}" + """ + WORKDIR=`pwd` + mv ${FastQC_Outputs_dir} FastQC_Outputs_dir + + [ -d ${OUT_DIR}/ ] || mkdir ${OUT_DIR}/ && \\ + cp -r FastQC_Outputs_dir/* ${OUT_DIR}/ + + [ -f ${OUT_DIR}/versions.txt ] && rm -rf ${OUT_DIR}/versions.txt + + cat `which clean-paths.sh` > \${WORKDIR}/clean-paths.sh + chmod +x \${WORKDIR}/clean-paths.sh + + echo "Purging paths from multiqc outputs" + cd \${WORKDIR}/${OUT_DIR}/ + echo "Cleaning raw multiqc files with path info" + unzip raw_multiqc${params.assay_suffix}_report.zip && rm raw_multiqc${params.assay_suffix}_report.zip + cd raw_multiqc_report/raw_multiqc_data/ + + # No reason not to just run it on all + echo "Purging paths in all raw QC files..." + find . -type f -exec bash \${WORKDIR}/clean-paths.sh '{}' ${params.baseDir} \\; + cd \${WORKDIR}/${OUT_DIR}/ + + echo "Re-zipping up raw multiqc" + zip -r raw_multiqc${params.assay_suffix}_report.zip raw_multiqc_report/ && rm -rf raw_multiqc_report/ + + echo "Cleaning filtered multiqc files with path info..." + unzip filtered_multiqc${params.assay_suffix}_report.zip && rm filtered_multiqc${params.assay_suffix}_report.zip + cd filtered_multiqc_report/filtered_multiqc_data/ + + + # No reason not to just run it on all + echo "Purging paths in all filtered QC files..." + find . -type f -exec bash \${WORKDIR}/clean-paths.sh '{}' ${params.baseDir} \\; + cd \${WORKDIR}/${OUT_DIR}/ + + + echo "Re-zipping up filtered multiqc..." + zip -r filtered_multiqc${params.assay_suffix}_report.zip filtered_multiqc_report/ && rm -rf filtered_multiqc_report/ + cd \${WORKDIR} + + echo "Purging paths from multiqc outputs completed successfully..." + + echo "Done! Paths purged successfully." + """ + +} + +process PACKAGE_PROCESSING_INFO { + + tag "Purging file paths and zipping processing info" + + input: + val(files_and_dirs) + output: + path("processing_info${params.assay_suffix}.zip"), emit: zip + + script: + """ + cat `which clean-paths.sh` > clean-paths.sh + chmod +x ./clean-paths.sh + [ -d processing_info/ ] || mkdir processing_info/ && \\ + cp -r ${files_and_dirs.join(" ")} processing_info/ + + echo "Purging file paths" + find processing_info/ -type f -exec bash ./clean-paths.sh '{}' ${params.baseDir} \\; + + # Purge file paths and then zip + zip -r processing_info${params.assay_suffix}.zip processing_info/ + """ +} + + +process GENERATE_README { + + beforeScript "chmod +x ${projectDir}/bin/*" + tag "Generating README for ${OSD_accession}" + input: + tuple val(name), val(email), val(output_prefix), + val(OSD_accession), val(protocol_id), + val(FastQC_Outputs), val(Filtered_Sequence_Data), + val(Read_Based_Processing), val(Assembly_Based_Processing), + val(Assemblies), val(Genes), val(Annotations_And_Tax), + val(Mapping), val(Combined_Output) + path(processing_info) + path(Bins) + path(MAGS) + output: + path("README${params.assay_suffix}.txt"), emit: readme + + script: + """ + GL-gen-processed-metagenomics-readme \\ + --output 'README${params.assay_suffix}.txt' \\ + --GLDS-ID '${OSD_accession}' \\ + --output-prefix '${output_prefix}' \\ + --name '${name}' \\ + --email '${email}' \\ + --protocol_ID '${protocol_id}' \\ + --assay_suffix '${params.assay_suffix}' \\ + --processing_zip_file '${processing_info}' \\ + --fastqc_dir '${FastQC_Outputs}' \\ + --filtered_reads_dir '${Filtered_Sequence_Data}' \\ + --read_based_dir '${Read_Based_Processing}' \\ + --assembly_based_dir '${Assembly_Based_Processing}' \\ + --assemblies_dir '${Assemblies}' \\ + --genes_dir '${Genes}' \\ + --annotations_and_tax_dir '${Annotations_And_Tax}' \\ + --mapping_dir '${Mapping}' \\ + --bins_dir '${Bins}' \\ + --MAGs_dir '${MAGS}' \\ + --combined_output_dir '${Combined_Output}' ${params.readme_extra} + """ + +} + + +process VALIDATE_PROCESSING { + + tag "Running automated validation and verification...." + + input: + // Labels + tuple val(GLDS_accession), val(V_V_guidelines_link), val(output_prefix), + val(target_files), val(assay_suffix), val(log_dir_basename), + val(raw_suffix), val(raw_R1_suffix), val(raw_R2_suffix), + val(filtered_suffix), val(filtered_R1_suffix), val(filtered_R2_suffix) + // Directory paths + tuple path(Filtered_Sequence_Data), path(Read_Based), + path(Assembly_Based), path(Assemblies), path(Mapping), + path(Genes), path(Annotation_And_Tax), path(Bins), + path(MAGS), path(Combined_Output), path(FastQC_Outputs) + // File paths + path(sample_ids_file) + path(README) + path(processing_info) + + output: + path("${GLDS_accession}_${output_prefix}metagenomics-validation.log"), emit: log + + script: + """ + GL-validate-processed-metagenomics-data \\ + --output '${GLDS_accession}_${output_prefix}metagenomics-validation.log' \\ + --GLDS-ID '${GLDS_accession}' \\ + --readme '${README}' \\ + --sample-IDs-file '${sample_ids_file}' \\ + --V_V_guidelines_link '${V_V_guidelines_link}' \\ + --processing_zip_file '${processing_info}' \\ + --output-prefix '${output_prefix}' \\ + --zip_targets '${target_files}' \\ + --assay_suffix '${assay_suffix}' \\ + --raw_suffix '${raw_suffix}' \\ + --raw_R1_suffix '${raw_R1_suffix}' \\ + --raw_R2_suffix '${raw_R2_suffix}' \\ + --filtered_suffix '${filtered_suffix}' \\ + --filtered_R1_suffix '${filtered_R1_suffix}' \\ + --filtered_R2_suffix '${filtered_R2_suffix}' \\ + --logs_dir_basename '${log_dir_basename}' \\ + --fastqc_dir ${FastQC_Outputs} \\ + --filtered_reads_dir ${Filtered_Sequence_Data} \\ + --read_based_dir ${Read_Based} \\ + --assembly_based_dir ${Assembly_Based} \\ + --assemblies_dir ${Assemblies} \\ + --genes_dir ${Genes} \\ + --annotations_and_tax_dir ${Annotation_And_Tax} \\ + --mapping_dir ${Mapping} \\ + --bins_dir ${Bins} \\ + --MAGs_dir ${MAGS} \\ + --combined_output_dir ${Combined_Output} ${params.validation_extra} + """ +} + + +process GENERATE_CURATION_TABLE { + + beforeScript "chmod +x ${projectDir}/bin/*" + tag "Generating a file association table for curation..." + + input: + // GeneLab accession and Suffixes + tuple val(GLDS_accession), val(output_prefix), val(assay_suffix), + val(raw_suffix), val(raw_R1_suffix), val(raw_R2_suffix), + val(filtered_suffix), val(filtered_R1_suffix), val(filtered_R2_suffix) + // File labels + tuple val(processing_zip_file), val(readme) + // Directory labels as paths - these paths are utilized as mere labels by the script + tuple path(raw_reads_dir), path(filtered_reads_dir), path(read_based_dir), + path(assembly_based_dir), path(annotation_and_tax_dir), path(combined_output_dir) + // Directory paths + tuple path(Assemblies), path(Genes), path(Mapping), + path(Bins), path(MAGS), path(FastQC_Outputs) + path(input_table) + path(runsheet) + + output: + path("${GLDS_accession}_${output_prefix}-associated-file-names.tsv"), emit: curation_table + + script: + def INPUT_TABLE = params.assay_table ? "--assay-table ${input_table}" : "--isa-zip ${input_table}" + """ + GL-gen-metagenomics-file-associations-table ${INPUT_TABLE} \\ + --runsheet '${runsheet}' \\ + --output '${GLDS_accession}_${output_prefix}-associated-file-names.tsv' \\ + --GLDS-ID '${GLDS_accession}' \\ + --output-prefix '${output_prefix}' \\ + --assay_suffix '${assay_suffix}' \\ + --raw_suffix '${raw_suffix}' \\ + --raw_R1_suffix '${raw_R1_suffix}' \\ + --raw_R2_suffix '${raw_R2_suffix}' \\ + --filtered_suffix '${filtered_suffix}' \\ + --filtered_R1_suffix '${filtered_R1_suffix}' \\ + --filtered_R2_suffix '${filtered_R2_suffix}' \\ + --processing_zip_file '${processing_zip_file}' \\ + --readme '${readme}' \\ + --fastqc_dir '${FastQC_Outputs}' \\ + --assemblies_dir '${Assemblies}' \\ + --genes_dir '${Genes}' \\ + --mapping_dir '${Mapping}' \\ + --bins_dir '${Bins}' \\ + --MAGs_dir '${MAGS}' \\ + --raw_reads_dir '${raw_reads_dir}' \\ + --filtered_reads_dir '${filtered_reads_dir}' \\ + --read_based_dir '${read_based_dir}' \\ + --assembly_based_dir '${assembly_based_dir}' \\ + --annotations_and_tax_dir '${annotation_and_tax_dir}' \\ + --combined_output_dir '${combined_output_dir}' ${params.file_association_extra} + """ +} + + +process GENERATE_MD5SUMS { + + tag "Generating md5sums for the files to be released on OSDR..." + + input: + path(processing_info) + path(README) + val(dirs) + + output: + path("processed_md5sum${params.assay_suffix}.tsv"), emit: md5sum + script: + """ + mkdir processing/ && \\ + cp -r ${dirs.join(" ")} ${processing_info} ${README} \\ + processing/ + + # Generate md5sums + find -L processing/ -type f -exec md5sum '{}' \\; | + awk -v OFS='\\t' 'BEGIN{OFS="\\t"; printf "File Path\\tFile Name\\tmd5\\n"} \\ + {N=split(\$2,a,"/"); sub(/processing\\//, "", \$2); print \$2,a[N],\$1}' \\ + | grep -v "versions.txt" > processed_md5sum${params.assay_suffix}.tsv + """ +} + + +process GENERATE_PROTOCOL { + + beforeScript "chmod +x ${projectDir}/bin/*" + tag "Generating your analysis protocol..." + + input: + path(software_versions) + val(protocol_id) + output: + path("protocol.txt") + script: + """ + generate_protocol.sh ${software_versions} ${protocol_id} > protocol.txt + """ +} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/quality_assessment.nf b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/quality_assessment.nf new file mode 100644 index 000000000..2addbdfd8 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/quality_assessment.nf @@ -0,0 +1,134 @@ +#!/usr/bin/env nextflow +nextflow.enable.dsl = 2 + +/**************************************************************************************** +********************* Sequence quality assessment and control processes **************** +****************************************************************************************/ + +// a 2-column (single-end) or 3-column (paired-end) file +//params.prefix = "raw" // "filetered" +//params.csv_file = "file.csv" +//params.swift_1S = false +//params.adapters = "${projectDir}/config/bbtools_dapters.fa" +//params.multiqc_config = "config/multiqc.config" + +process FASTQC { + // FastQC performed on reads + tag "Running fastqc on ${sample_id}" + + input: + tuple val(sample_id), path(reads), val(isPaired) + output: + tuple path("*.html"), path("*.zip"), emit: html + path("versions.txt"), emit: version + script: + """ + fastqc -o . \\ + -t ${task.cpus} \\ + ${reads} + + fastqc --version > versions.txt + """ +} + +process MULTIQC { + + tag "Running multiqc on the ${prefix} files.." + + input: + val(prefix) + path(multiqc_config) + path(files) + output: + path("${params.additional_filename_prefix}${prefix}_multiqc${params.assay_suffix}_report.zip"), emit: report + path("versions.txt"), emit: version + script: + """ + multiqc -q --filename ${params.additional_filename_prefix}${prefix}_multiqc \\ + --force --cl-config 'max_table_rows: 99999999' \\ + --interactive --config ${multiqc_config} \\ + --outdir ${params.additional_filename_prefix}${prefix}_multiqc_report ${files} > /dev/null 2>&1 + + + # zipping and removing unzipped dir + zip -q -r \\ + ${params.additional_filename_prefix}${prefix}_multiqc${params.assay_suffix}_report.zip \\ + ${params.additional_filename_prefix}${prefix}_multiqc_report + + multiqc --version > versions.txt + """ + } + + +// This process runs quality filtering/trimming on input fastq files. +process BBDUK { + + + tag "Quality filtering ${sample_id}-s reads.." + beforeScript "chmod +x ${projectDir}/bin/*" + + input: + tuple val(sample_id), path(reads), val(isPaired) + path(adapters) + output: + tuple val(sample_id), path("*${params.filtered_suffix}"), val(isPaired), emit: reads + path("${sample_id}-bbduk.log"), emit: log + path("versions.txt"), emit: version + script: + def isSwift = params.swift_1S ? 't' : 'f' + """ + if [ ${isPaired} == true ];then + + bbduk.sh in=${reads[0]} in2=${reads[1]} \\ + out1=${sample_id}${params.filtered_R1_suffix} \\ + out2=${sample_id}${params.filtered_R2_suffix} \\ + ref=${adapters} \\ + ktrim=l k=17 ftm=5 qtrim=rl \\ + trimq=10 mlf=0.5 maxns=0 swift=${isSwift} > ${sample_id}-bbduk.log 2>&1 + else + + bbduk.sh in=${reads[0]} out1=${sample_id}${params.filtered_suffix} \\ + ref=${adapters} \\ + ktrim=l k=17 ftm=5 qtrim=rl \\ + trimq=10 mlf=0.5 maxns=0 swift=${isSwift} > ${sample_id}-bbduk.log 2>&1 + + fi + + VERSION=`bbversion.sh` + echo "bbtools \${VERSION}" > versions.txt + """ +} + + +workflow quality_check { + + take: + prefix_ch + multiqc_config + reads_ch + + + main: + FASTQC(reads_ch) + fastqc_ch = FASTQC.out.html.flatten().collect() + MULTIQC(prefix_ch, multiqc_config, fastqc_ch) + + software_versions_ch = Channel.empty() + FASTQC.out.version | mix(software_versions_ch) | set{software_versions_ch} + MULTIQC.out.version | mix(software_versions_ch) | set{software_versions_ch} + + emit: + versions = software_versions_ch +} + +workflow { + + Channel.fromPath(params.input_file) + .splitCsv() + .map{ row -> row.paired == 'true' ? tuple( "${row.sample_id}", [file("${row.forward}", checkIfExists: true), file("${row.reverse}", checkIfExists: true)], row.paired) : + tuple( "${row.sample_id}", [file("${row.forward}", checkIfExists: true)], row.paired)} + .set{reads_ch} + + res_ch = quality_check(Channel.of(params.prefix), params.multiqc_config, reads_ch) + BBDUK(reads_ch, params.adapters) +} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/read_based_processing.nf b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/read_based_processing.nf new file mode 100644 index 000000000..957b09a5c --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/read_based_processing.nf @@ -0,0 +1,307 @@ +#!/usr/bin/env nextflow +nextflow.enable.dsl = 2 +//params.additional_filename_prefix = "" +//params.assay_suffix = "_GLmetagenomics" + +/**************************************************************************************** +********************* Read-based processing using Humann3 ******************************* +****************************************************************************************/ + + +/* + This process runs humann3 and metaphlan4 on each individual sample generating the + read-based functional annotations and taxonomic classifications. +*/ + +process HUMANN { + + tag "Running humann on ${sample_id}-s reads..." + label "read_based" + + + input: + tuple val(sample_id), path(reads), val(isPaired) + path(chocophlan_dir) + path(uniref_dir) + path(metaphlan_dir) + + output: + path("${sample_id}-humann3-out-dir/${sample_id}_genefamilies.tsv"), emit: genefamilies + path("${sample_id}-humann3-out-dir/${sample_id}_pathabundance.tsv"), emit: pathabundance + path("${sample_id}-humann3-out-dir/${sample_id}_pathcoverage.tsv"), emit: pathcoverage + path("${sample_id}-humann3-out-dir/${sample_id}_metaphlan_bugs_list.tsv"), emit: metaphlan_bugs_list + path("versions.txt"), emit: version + script: + """ + zcat ${reads} > ${sample_id}-reads.tmp.fq + + humann --input ${sample_id}-reads.tmp.fq \\ + --output ${sample_id}-humann3-out-dir/ \\ + --threads ${task.cpus} \\ + --output-basename ${sample_id} \\ + --metaphlan-options "--bowtie2db ${metaphlan_dir} --unclassified_estimation --add_viruses --sample_id ${sample_id}" \\ + --nucleotide-database ${chocophlan_dir} \\ + --protein-database ${uniref_dir} \\ + --bowtie-options "--sensitive --mm" && \\ + mv ${sample_id}-humann3-out-dir/${sample_id}_humann_temp/${sample_id}_metaphlan_bugs_list.tsv \\ + ${sample_id}-humann3-out-dir/${sample_id}_metaphlan_bugs_list.tsv + + humann3 --version > versions.txt + """ +} + + +/* + This process combines the read-based humann3 output functional + tables from indiviual samples into single tables across the GLDS dataset. +*/ + +process COMBINE_READ_BASED_PROCESSING_TABLES { + + tag "Combining the read based processing tables..." + label "read_based" + + input: + path(gene_families) + path(path_abundances) + path(path_coverages) + path(utilities_path) + output: + path("${params.additional_filename_prefix}gene-families-initial.tsv"), emit: gene_families + path("${params.additional_filename_prefix}pathway-abundances-initial.tsv"), emit: path_abundances + path("${params.additional_filename_prefix}pathway-coverages-initial.tsv"), emit: path_coverages + path("versions.txt"), emit: version + script: + """ + if [ ${params.use_conda} == true ]; then + # Setting humann3 utilities location (can be off if we pointed to + # a previously installed database, and doesn't hurt to reset if it was already good-to-go) + humann_config --update database_folders utility_mapping ${utilities_path} > /dev/null 2>&1 + fi + + # they each need to be in the same directories to be merged + mkdir -p gene-family-results/ path-abundance-results/ path-coverage-results/ + cp ${gene_families} gene-family-results/ + cp ${path_abundances} path-abundance-results/ + cp ${path_coverages} path-coverage-results/ + + humann_join_tables -i gene-family-results/ -o ${params.additional_filename_prefix}gene-families-initial.tsv > /dev/null 2>&1 + humann_join_tables -i path-abundance-results/ -o ${params.additional_filename_prefix}pathway-abundances-initial.tsv > /dev/null 2>&1 + humann_join_tables -i path-coverage-results/ -o ${params.additional_filename_prefix}pathway-coverages-initial.tsv > /dev/null 2>&1 + + humann3 --version > versions.txt + """ +} + + +/* + The read-based functional annotation tables have taxonomic info and non-taxonomic info mixed + together initially. Humann comes with utility scripts to split these. This process does that, + generating non-taxonomically grouped functional info files and taxonomically grouped ones. +*/ + +process SPLIT_READ_BASED_PROCESSING_TABLES { + + tag "Splitting humann stratified tables..." + label "read_based" + label "read_based_outputs" + + input: + path(gene_families) + path(path_abundances) + path(path_coverages) + output: + path("${params.additional_filename_prefix}Gene-families${params.assay_suffix}.tsv"), emit: gene_families + path("${params.additional_filename_prefix}Gene-families-grouped-by-taxa${params.assay_suffix}.tsv"), emit: gene_families_grouped + path("${params.additional_filename_prefix}Pathway-abundances${params.assay_suffix}.tsv"), emit: path_abundances + path("${params.additional_filename_prefix}Pathway-abundances-grouped-by-taxa${params.assay_suffix}.tsv"), emit: path_abundances_grouped + path("${params.additional_filename_prefix}Pathway-coverages${params.assay_suffix}.tsv"), emit: path_coverages + path("${params.additional_filename_prefix}Pathway-coverages-grouped-by-taxa${params.assay_suffix}.tsv"), emit: path_coverages_grouped + path("versions.txt"), emit: version + script: + """ + [ -d temp_processing/ ] && rm -rf temp_processing/ + mkdir temp_processing/ + + # Gene Families + humann_split_stratified_table -i ${gene_families} -o temp_processing/ > /dev/null 2>&1 + mv temp_processing/${params.additional_filename_prefix}gene-families-initial_stratified.tsv \\ + ${params.additional_filename_prefix}Gene-families-grouped-by-taxa${params.assay_suffix}.tsv + + mv temp_processing/${params.additional_filename_prefix}gene-families-initial_unstratified.tsv \\ + ${params.additional_filename_prefix}Gene-families${params.assay_suffix}.tsv + + # Pathway Abundance + humann_split_stratified_table -i ${path_abundances} -o temp_processing/ > /dev/null 2>&1 + mv temp_processing/${params.additional_filename_prefix}pathway-abundances-initial_stratified.tsv \\ + ${params.additional_filename_prefix}Pathway-abundances-grouped-by-taxa${params.assay_suffix}.tsv + + mv temp_processing/${params.additional_filename_prefix}pathway-abundances-initial_unstratified.tsv \\ + ${params.additional_filename_prefix}Pathway-abundances${params.assay_suffix}.tsv + + # Pathway Coverage + humann_split_stratified_table -i ${path_coverages} -o temp_processing/ > /dev/null 2>&1 + mv temp_processing/${params.additional_filename_prefix}pathway-coverages-initial_stratified.tsv \\ + ${params.additional_filename_prefix}Pathway-coverages-grouped-by-taxa${params.assay_suffix}.tsv + + mv temp_processing/${params.additional_filename_prefix}pathway-coverages-initial_unstratified.tsv \\ + ${params.additional_filename_prefix}Pathway-coverages${params.assay_suffix}.tsv + + humann3 --version > versions.txt + """ +} + + +/* + This process generates some normalized tables of the read-based functional outputs from + humann that are more readily suitable for across sample comparisons. +*/ + +process GEN_NORMALIZED_READ_BASED_PROCESSING_TABLES { + + tag "Generating normalized humann tables..." + label "read_based" + label "read_based_outputs" + + input: + path(gene_families) + path(path_abundances) + output: + path("${params.additional_filename_prefix}Gene-families-cpm${params.assay_suffix}.tsv"), emit: gene_families + path("${params.additional_filename_prefix}Pathway-abundances-cpm${params.assay_suffix}.tsv"), emit: path_abundances + path("versions.txt"), emit: version + script: + """ + humann_renorm_table \\ + -i ${gene_families} \\ + -o ${params.additional_filename_prefix}Gene-families-cpm${params.assay_suffix}.tsv \\ + --update-snames > /dev/null 2>&1 + + humann_renorm_table \\ + -i ${path_abundances} \\ + -o ${params.additional_filename_prefix}Pathway-abundances-cpm${params.assay_suffix}.tsv \\ + --update-snames > /dev/null 2>&1 + + humann3 --version > versions.txt + """ +} + + +/* + This process summarizes the read-based humann annotations based on Kegg Orthlogy terms. +*/ + +process GEN_READ_BASED_PROCESSING_KO_TABLE { + + tag "Retrieving Kegg Orthologs..." + label "read_based" + label "read_based_outputs" + + input: + path(gene_families) + output: + path("${params.additional_filename_prefix}Gene-families-KO-cpm${params.assay_suffix}.tsv"), emit: gene_families + path("versions.txt"), emit: version + script: + """ + humann_regroup_table \\ + -i ${gene_families} \\ + -g uniref90_ko 2> /dev/null | \\ + humann_rename_table \\ + -n kegg-orthology 2> /dev/null | \\ + humann_renorm_table \\ + -o ${params.additional_filename_prefix}Gene-families-KO-cpm${params.assay_suffix}.tsv \\ + --update-snames > /dev/null 2>&1 + + humann3 --version > versions.txt + """ +} + + + +//This process merges the taxonomy tables generated by metaphlan +process COMBINE_READ_BASED_PROCESSING_TAXONOMY { + + tag "Merging metaphlan taxonomy tables..." + label "read_based" + label "read_based_outputs" + + input: + path(metaphlan_bugs_list_files) + output: + path("${params.additional_filename_prefix}Metaphlan-taxonomy${params.assay_suffix}.tsv"), emit: taxonomy + path("versions.txt"), emit: version + script: + """ + merge_metaphlan_tables.py ${metaphlan_bugs_list_files} \\ + > ${params.additional_filename_prefix}Metaphlan-taxonomy${params.assay_suffix}.tsv 2> /dev/null + + # Removing redundant text from headers + sed -i 's/_metaphlan_bugs_list//g' ${params.additional_filename_prefix}Metaphlan-taxonomy${params.assay_suffix}.tsv + + metaphlan --version > versions.txt + """ +} + + + +workflow read_based { + + take: + filtered_reads + chocophlan_dir + uniref_dir + metaphlan_dir + utilities_path + + main: + + + HUMANN(filtered_reads, chocophlan_dir, uniref_dir, metaphlan_dir) + + gene_families_ch = HUMANN.out.genefamilies.collect() + pathabundance_ch = HUMANN.out.pathabundance.collect() + pathcoverage_ch = HUMANN.out.pathcoverage.collect() + metaphlan_bugs_list_ch = HUMANN.out.metaphlan_bugs_list.collect() + + COMBINE_READ_BASED_PROCESSING_TABLES(gene_families_ch, pathabundance_ch, pathcoverage_ch, utilities_path) + + SPLIT_READ_BASED_PROCESSING_TABLES(COMBINE_READ_BASED_PROCESSING_TABLES.out.gene_families, + COMBINE_READ_BASED_PROCESSING_TABLES.out.path_abundances, + COMBINE_READ_BASED_PROCESSING_TABLES.out.path_coverages) + + GEN_NORMALIZED_READ_BASED_PROCESSING_TABLES(SPLIT_READ_BASED_PROCESSING_TABLES.out.gene_families, + SPLIT_READ_BASED_PROCESSING_TABLES.out.path_abundances) + + GEN_READ_BASED_PROCESSING_KO_TABLE(SPLIT_READ_BASED_PROCESSING_TABLES.out.gene_families) + ko_table_ch = GEN_READ_BASED_PROCESSING_KO_TABLE.out.gene_families + + COMBINE_READ_BASED_PROCESSING_TAXONOMY(metaphlan_bugs_list_ch) + taxonomy_ch = COMBINE_READ_BASED_PROCESSING_TAXONOMY.out.taxonomy + + software_versions_ch = Channel.empty() + HUMANN.out.version | mix(software_versions_ch) | set{software_versions_ch} + COMBINE_READ_BASED_PROCESSING_TABLES.out.version | mix(software_versions_ch) | set{software_versions_ch} + SPLIT_READ_BASED_PROCESSING_TABLES.out.version | mix(software_versions_ch) | set{software_versions_ch} + GEN_NORMALIZED_READ_BASED_PROCESSING_TABLES.out.version | mix(software_versions_ch) | set{software_versions_ch} + GEN_READ_BASED_PROCESSING_KO_TABLE.out.version | mix(software_versions_ch) | set{software_versions_ch} + COMBINE_READ_BASED_PROCESSING_TAXONOMY.out.version | mix(software_versions_ch) | set{software_versions_ch} + + emit: + gene_families = GEN_NORMALIZED_READ_BASED_PROCESSING_TABLES.out.gene_families + path_abundances = GEN_NORMALIZED_READ_BASED_PROCESSING_TABLES.out.path_abundances + ko_table = ko_table_ch + taxonomy = taxonomy_ch + versions = software_versions_ch +} + + +workflow { + + read_based(filtered_reads_ch, + params.chocophlan_dir, + params.uniref_dir, + params.metaphlan_db_dir, + params.utilities_dir) + +} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/read_mapping.nf b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/read_mapping.nf new file mode 100644 index 000000000..a80969073 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/read_mapping.nf @@ -0,0 +1,90 @@ +#!/usr/bin/env nextflow +nextflow.enable.dsl = 2 + +/**************************************************************************************** +********************* Read mapping to contig assembly using Bowtie2 ******************** +****************************************************************************************/ + +// This process builds the bowtie2 index and runs the mapping for each sample +process MAPPING { + + tag "Mapping ${sample_id}-s reads to its assembly ${assembly}..." + label "mapping" + + input: + tuple val(sample_id), path(assembly), path(reads), val(isPaired) + output: + tuple val(sample_id), path("${sample_id}.sam"), path("${sample_id}-mapping-info.txt"), emit: sam + path("versions.txt"), emit: version + script: + """ + if [ ${isPaired} == 'true' ]; then + # Only running if the assembly produced anything + if [ -s ${assembly} ]; then + + bowtie2-build ${assembly} ${sample_id}-index + bowtie2 --mm -q --threads ${task.cpus} \\ + -x ${sample_id}-index -1 ${reads[0]} -2 ${reads[1]} \\ + --no-unal > ${sample_id}.sam 2> ${sample_id}-mapping-info.txt + rm ${sample_id}-index* + else + + touch ${sample_id}.sam + echo "Mapping not performed for ${sample_id} because the assembly didn't produce anything." > ${sample_id}-mapping-info.txt + printf "Mapping not performed for ${sample_id} because the assembly didn't produce anything.\\n" + + fi + # Single-end + else + + # Only running if the assembly produced anything + if [ -s ${assembly} ]; then + + bowtie2-build ${assembly} ${sample_id}-index + bowtie2 --mm -q --threads ${task.cpus} \\ + -x ${sample_id}-index -r ${reads[0]} \\ + --no-unal > ${sample_id}.sam 2> ${sample_id}-mapping-info.txt + + rm ${sample_id}-index* + else + + touch ${sample_id}.sam + echo "Mapping not performed for ${sample_id} because the assembly didn't produce anything." > ${sample_id}-mapping-info.txt + printf "Mapping not performed for ${sample_id} because the assembly didn't produce anything.\\n" + + fi + + fi + bowtie2 --version | head -n 1 | sed -E 's/.*(bowtie2-align-s version.+)/\\1/' > versions.txt + """ +} + + + +// This process builds the bowtie2 index and runs the mapping for each sample +process SAM_TO_BAM { + + tag "Sorting and converting ${sample_id}-s sam to bam files..." + label "mapping" + + input: + tuple val(sample_id), path(sam), path(mapping_info) + output: + tuple val(sample_id), path("${sample_id}.bam"), emit: bam + path("versions.txt"), emit: version + script: + """ + # Only running if the assembly produced anything + if [ -s ${sam} ]; then + + samtools sort -@ ${task.cpus} ${sam} > ${sample_id}.bam 2> /dev/null + + else + + touch ${sample_id}.bam + printf "Sorting and converting not performed for ${sample_id} because read mapping didn't produce anything.\\n" + + fi + samtools --version | head -n1 > versions.txt + """ +} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/summarize_MAG.nf b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/summarize_MAG.nf new file mode 100644 index 000000000..882c22a3e --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/summarize_MAG.nf @@ -0,0 +1,364 @@ +#!/usr/bin/env nextflow +nextflow.enable.dsl = 2 + +/**************************************************************************************** +********************* Summarize Meta assembled genomes (MAGs) ************************** +****************************************************************************************/ +include { ZIP_FASTA as ZIP_MAGS } from "./zip_fasta.nf" + +//params.min_est_comp = 90 +//params.max_est_redund = 10 +//params.max_est_strain_het = 50 + +/* +Scratch directory for gtdb-tk, if wanting to use disk space instead of RAM, can be memory intensive; +see https://ecogenomics.github.io/GTDBTk/faq.html#gtdb-tk-reaches-the-memory-limit-pplacer-crashes +leave empty if wanting to use memory, the default, put in quotes the path to a directory that +already exists if wanting to use disk space +*/ + +//params.gtdb_tk_scratch_location = "" + +/* Retrieve MAGS. + Filters checkm results based on estimate completion, redundancy, and + strain heterogeneity. Defaults are conservatively 90, 10, and 50 +*/ + +process FILTER_CHECKM_RESULTS_AND_COPY_MAGS { + + tag "Filtering checkm-s results..." + label "bit" + + input: + path(bins_checkm_results) + path(bins) + output: + path("${params.additional_filename_prefix}MAGs-checkm-out.tsv"), emit: MAGs_checkm_out + path("MAGs_dir/"), emit: MAGs_dir + script: + """ + # Only running if there were bins recovered + if [ `find -L . -name '*.fasta' | wc -l | sed 's/^ *//'` -gt 0 ]; then + + cat <( printf "Bin Id\\tMarker lineage\\t# genomes\\t# markers\\t# marker sets\\t0\\t1\\t2\\t3\\t4\\t5+\\tCompleteness\\tContamination\\tStrain heterogeneity\\n" ) \\ + <( awk -F '\\t' ' \$12 >= ${params.min_est_comp} && \$13 <= ${params.max_est_redund} && \$14 <= ${params.max_est_strain_het} ' ${bins_checkm_results} ) \\ + > MAGs-checkm-out.tmp + + sed 's/-bin\\./-MAG-/' MAGs-checkm-out.tmp > ${params.additional_filename_prefix}MAGs-checkm-out.tsv + + [ -d MAGs_dir/ ] || mkdir MAGs_dir/ + for MAG in `cut -f 1 MAGs-checkm-out.tmp | tail -n +2` + do + new_ID=`echo \$MAG | sed 's/-bin\\./-MAG-/'` + cp \$MAG.fasta MAGs_dir/\${new_ID}.fasta + done + + else + + printf "There were no MAGs recovered.\\n" > ${params.additional_filename_prefix}MAGs-checkm-out.tsv + + fi + """ +} + +// Assign taxonomy to MAGs with gtdb-tk + +process GTDBTK_ON_MAGS { + + tag "Assigning taxonomy to your MAGs with gtdb-tk..." + + input: + path(MAGs_checkm_out) + path(MAGs_dir) + path(gtdbtk_db_dir) + val(use_gtdbtk_scratch_location) + env(GTDBTK_DATA_PATH) + + output: + path("gtdbtk-out/"), emit: gtdbtk_out + path("versions.txt"), emit: version + script: + """ + # Only running if any MAGs were recovered + if [ `find -L ${MAGs_dir} -name '*.fasta' | wc -l | sed 's/^ *//'` -gt 0 ]; then + + if [ ${use_gtdbtk_scratch_location} == 'true' ]; then + + [ -d gtdbtk_scratch_location/ ] || mkdir gtdbtk_scratch_location/ + + gtdbtk classify_wf \\ + --scratch_dir gtdbtk_scratch_location/ \\ + --genome_dir ${MAGs_dir} \\ + -x fasta \\ + --out_dir gtdbtk-out/ \\ + --cpus ${task.cpus} \\ + --skip_ani_screen + + else + + gtdbtk classify_wf \\ + --genome_dir ${MAGs_dir} \\ + -x fasta \\ + --out_dir gtdbtk-out/ \\ + --cpus ${task.cpus} \\ + --skip_ani_screen + + fi + + else + + mkdir -p gtdbtk-out/ + printf "There were no MAGs recovered.\\n" \\ + > gtdbtk-out/No-MAGs-recovered.txt + + printf "\\n\\nThere were no MAGs recovered, so GTDB-tk was not run.\\n\\n" + + fi + gtdbtk -h |grep "GTDB-Tk" | sed -E 's/.+\\s+(GTDB-Tk v.+)\\s+.+/\\1/' > versions.txt + """ +} + + + +// Summarize MAG assemblies +process SUMMARIZE_MAG_ASSEMBLIES { + + tag "Summarizing MAG assemblies..." + label "bit" + + input: + path(MAGs_dir) + output: + path("${params.additional_filename_prefix}MAG-assembly-summaries.tsv"), emit: summary + path("versions.txt"), emit: version + script: + """ + # Only running if any MAGs were recovered + if [ `find -L ${MAGs_dir} -name '*.fasta' | wc -l | sed 's/^ *//'` -gt 0 ]; then + + # Remove fasta index if already exists + rm -rf ${MAGs_dir}/*.fxi + bit-summarize-assembly ${MAGs_dir}/*.fasta -o MAG-summaries.tmp -t + + # Slimming down the output + cut -f 1,2,3,5,6,8,11,18,19,20 MAG-summaries.tmp \\ + > ${params.additional_filename_prefix}MAG-assembly-summaries.tsv + + else + + printf "There were no MAGs recovered.\\n" \\ + > ${params.additional_filename_prefix}MAG-assembly-summaries.tsv + + fi + bit-version |grep "Bioinformatics Tools"|sed -E 's/^\\s+//' > versions.txt + """ +} + +process GENERATE_MAGS_OVERVIEW_TABLE { + + tag "Generating an overview table of all MAGs..." + label "mags" + label "bit" + + input: + path(MAG_assembly_summaries) + path(MAGs_checkm_out) + path(gtdbtk_out) + path(MAGs_dir) + output: + path("${params.additional_filename_prefix}MAGs-overview${params.assay_suffix}.tsv") + + script: + """ + # Only running if any MAGs were recovered + if [ `find -L ${MAGs_dir} -name '*.fasta' | wc -l | sed 's/^ *//'` -gt 0 ]; then + + #--------------------------- get_MAGs_estimates_and_taxonomy.sh ------------------------------------# + get_MAGs_estimates_and_taxonomy.sh ${MAGs_dir} ${MAG_assembly_summaries} ${MAGs_checkm_out} ${gtdbtk_out} + #----------------------------------------------------------------------------------------------------# + + # Adding headers + cat <(printf "est. completeness\\test. redundancy\\test. strain heterogeneity\\n") \\ + checkm-estimates.tmp > checkm-estimates-with-headers.tmp + + cat <(printf "domain\\tphylum\\tclass\\torder\\tfamily\\tgenus\\tspecies\\n") \\ + gtdb-taxonomies.tmp > gtdb-taxonomies-with-headers.tmp + + paste ${MAG_assembly_summaries} \\ + checkm-estimates-with-headers.tmp \\ + gtdb-taxonomies-with-headers.tmp \\ + > MAGs-overview.tmp + + # Ordering by taxonomy + head -n 1 MAGs-overview.tmp > MAGs-overview-header.tmp + + tail -n +2 MAGs-overview.tmp | \\ + sort -t \$'\\t' -k 14,20 > MAGs-overview-sorted.tmp + + cat MAGs-overview-header.tmp MAGs-overview-sorted.tmp \\ + > ${params.additional_filename_prefix}MAGs-overview${params.assay_suffix}.tsv + + else + + printf "There were no MAGs recovered.\\n" \\ + > ${params.additional_filename_prefix}MAGs-overview${params.assay_suffix}.tsv + + fi + """ +} + + +process SUMMARIZE_MAG_LEVEL_KO_ANNOTATIONS { + + tag "Parsing MAG KO annotations..." + label "mags" + label "bit" + + input: + path(MAGs_overview) + path(gene_coverage_annotation_and_tax_files) + path(MAGs_dir) + output: + path("${params.additional_filename_prefix}MAG-level-KO-annotations${params.assay_suffix}.tsv"), emit: summary + path("versions.txt"), emit: version + script: + """ + # Only running if any MAGs were recovered + if [ `find -L ${MAGs_dir} -name '*.fasta' | wc -l | sed 's/^ *//'` -gt 0 ]; then + + for MAG in `cut -f 1 ${MAGs_overview} | tail -n +2` + do + + sample_ID=`echo \$MAG | sed 's/-MAG-[0-9]*\$//'` + grep "^>" ${MAGs_dir}/\$MAG.fasta | tr -d ">" > curr-contig-ids.tmp + + parse-MAG-annots.py \\ + -i \${sample_ID}-gene-coverage-annotation-and-tax.tsv \\ + -w curr-contig-ids.tmp \\ + -M \$MAG \\ + -o ${params.additional_filename_prefix}MAG-level-KO-annotations${params.assay_suffix}.tsv + + done + + else + + printf "There were no MAGs recovered.\\n" \\ + > ${params.additional_filename_prefix}MAG-level-KO-annotations${params.assay_suffix}.tsv + + fi + python --version > versions.txt + """ +} + + +process SUMMARIZE_MAG_KO_ANNOTS_WITH_KEGG_DECODER { + + tag "Summarizing MAG KO annotations using kegg decoder..." + label "mags" + + + input: + path(MAG_level_KO_annotations) + path(MAGs_dir) + output: + path("${params.additional_filename_prefix}MAG-KEGG-Decoder-out${params.assay_suffix}.*"), emit: summary + path("versions.txt"), emit: version + script: + """ + # Getting number of MAGs recovered + num_mags_recovered=`find -L ${MAGs_dir}/ -name '*.fasta' | wc -l | sed 's/^ *//'` + # Only running if any MAGs were recovered + if [ \$num_mags_recovered -gt 0 ]; then + + # KEGGDecoder splits on the first underscore to identify unique genome/MAG IDs + # this can be problematic with how things are named, so we are swapping them all to not have + # any "_" first, then afterwards we are changing the output table back to the original names so + # they match elsewhere (they will still be slightly different in the html output, but that is + # only manually explored anyway) + + # Making version of input for KEGGDecoder with no underscores + tr "_" "-" < ${MAG_level_KO_annotations} > mod-MAG-level-KO-annotations.tmp + + # Making mapping file + paste <( cut -f 1 ${MAG_level_KO_annotations} ) \\ + <( cut -f 1 mod-MAG-level-KO-annotations.tmp ) \\ + > MAG-ID-map.tmp + + # Running KEGGDecoder + # can only create html output if there are more than 1 + if [ \$num_mags_recovered -gt 1 ]; then + KEGG-decoder -v interactive -i mod-MAG-level-KO-annotations.tmp -o MAG-KEGG-Decoder-out.tmp + + ## adding additional prefix to html output if there is one + [ -f MAG-KEGG-Decoder-out.html ] && \\ + mv MAG-KEGG-Decoder-out.html ${params.additional_filename_prefix}MAG-KEGG-Decoder-out${params.assay_suffix}.html + + else + KEGG-decoder -i mod-MAG-level-KO-annotations.tmp -o MAG-KEGG-Decoder-out.tmp + fi + + # Swapping MAG IDs back in output tsv from KEGGDecoder + swap-MAG-IDs.py -i MAG-KEGG-Decoder-out.tmp -m MAG-ID-map.tmp -o MAG-KEGG-Decoder-out.tsv && \\ + mv MAG-KEGG-Decoder-out.tsv \\ + ${params.additional_filename_prefix}MAG-KEGG-Decoder-out${params.assay_suffix}.tsv + + + else + + printf "There were no MAGs recovered.\\n" \\ + > ${params.additional_filename_prefix}MAG-KEGG-Decoder-out${params.assay_suffix}.tsv + + fi + python --version > versions.txt + """ +} + + + +workflow summarize_mags { + take: + bins_checkm_results_ch + bins_ch + gtdbtk_db_dir + use_gtdbtk_scratch_location + gene_coverage_annotation_and_tax_files_ch + + + main: + FILTER_CHECKM_RESULTS_AND_COPY_MAGS(bins_checkm_results_ch, bins_ch) + MAGs_checkm_out_ch = FILTER_CHECKM_RESULTS_AND_COPY_MAGS.out.MAGs_checkm_out + MAGs_dir_ch = FILTER_CHECKM_RESULTS_AND_COPY_MAGS.out.MAGs_dir + ZIP_MAGS(Channel.of("MAG"), MAGs_dir_ch) + + GTDBTK_ON_MAGS(MAGs_checkm_out_ch, MAGs_dir_ch, gtdbtk_db_dir, use_gtdbtk_scratch_location, gtdbtk_db_dir) + gtdbtk_out_ch = GTDBTK_ON_MAGS.out.gtdbtk_out + + SUMMARIZE_MAG_ASSEMBLIES(MAGs_dir_ch) + MAG_assembly_summaries_ch = SUMMARIZE_MAG_ASSEMBLIES.out.summary + + MAGs_overview_ch = GENERATE_MAGS_OVERVIEW_TABLE(MAG_assembly_summaries_ch, + MAGs_checkm_out_ch, + gtdbtk_out_ch, + MAGs_dir_ch) + + SUMMARIZE_MAG_LEVEL_KO_ANNOTATIONS(MAGs_overview_ch, + gene_coverage_annotation_and_tax_files_ch, + MAGs_dir_ch) + MAG_level_KO_annotations_ch = SUMMARIZE_MAG_LEVEL_KO_ANNOTATIONS.out.summary + + SUMMARIZE_MAG_KO_ANNOTS_WITH_KEGG_DECODER(MAG_level_KO_annotations_ch, MAGs_dir_ch) + + // Capture software versions + software_versions_ch = Channel.empty() + ZIP_MAGS.out.version | mix(software_versions_ch) | set{software_versions_ch} + GTDBTK_ON_MAGS.out.version | mix(software_versions_ch) | set{software_versions_ch} + SUMMARIZE_MAG_ASSEMBLIES.out.version | mix(software_versions_ch) | set{software_versions_ch} + SUMMARIZE_MAG_LEVEL_KO_ANNOTATIONS.out.version | mix(software_versions_ch) | set{software_versions_ch} + SUMMARIZE_MAG_KO_ANNOTS_WITH_KEGG_DECODER.out.version | mix(software_versions_ch) | set{software_versions_ch} + + emit: + MAGs_overview = MAGs_overview_ch + MAGs_dir = MAGs_dir_ch + versions = software_versions_ch + +} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/summarize_assembly-based_processing.nf b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/summarize_assembly-based_processing.nf new file mode 100644 index 000000000..3822fc91e --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/summarize_assembly-based_processing.nf @@ -0,0 +1,40 @@ +#!/usr/bin/env nextflow +nextflow.enable.dsl = 2 + +/**************************************************************************************** +********************* Summarize Assembly based metagenomics processing ************************** +****************************************************************************************/ + +process GENERATE_ASSEMBLY_PROCESSING_OVERVIEW_TABLE { + + tag "Summarizing the results of assemnly processing...." + label "bit" + + input: + path(sample_IDs_file) + path(MAGs_overview) + path(MAGs_dir) + path(assemblies) + path(genes_aa) + path(metabat_assembly_depth_files) + path(bins) + path(bam_files) + output: + path("${params.additional_filename_prefix}Assembly-based-processing-overview${params.assay_suffix}.tsv") + script: + """ + mkdir assemblies_dir/ && mv *-assembly.fasta assemblies_dir/ + mkdir genes_dir/ && mv *-genes.faa genes_dir/ + mkdir mapping_dir/ && mv *-metabat-assembly-depth.tsv *.bam mapping_dir/ + mkdir bins_dir/ && mv *-bin*.fasta bins_dir/ + bash generate-assembly-based-overview-table.sh \\ + ${sample_IDs_file} \\ + assemblies_dir/ \\ + genes_dir/ \\ + mapping_dir/ \\ + bins_dir/ \\ + ${MAGs_dir}/ \\ + ${params.additional_filename_prefix}Assembly-based-processing-overview${params.assay_suffix}.tsv + """ +} + diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/summarize_bins.nf b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/summarize_bins.nf new file mode 100644 index 000000000..d5e0d06b9 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/summarize_bins.nf @@ -0,0 +1,202 @@ +#!/usr/bin/env nextflow +nextflow.enable.dsl = 2 + +/**************************************************************************************** +********************* Bin check and summary ******************************************** +****************************************************************************************/ + +include { ZIP_FASTA as ZIP_BINS } from "./zip_fasta.nf" + +//params.reduced_tree = "True" + +// Summarize bin assemblies +process SUMMARIZE_BIN_ASSEMBLIES { + + tag "Getting a summary of the recovered bins..." + label "bins" + label "bit" + + input: + path(bins) + output: + path("${params.additional_filename_prefix}bin-assembly-summaries.tsv"), emit: summary + path("versions.txt"), emit: version + script: + """ + # Only running if any bins were recovered + if [ `find -L . -name '*.fasta' | wc -l | sed 's/^ *//'` -gt 0 ]; then + + bit-summarize-assembly *.fasta -o bin-summaries.tmp -t + + # Slimming down the output + cut -f 1,2,3,5,6,8,11,18,19,20 bin-summaries.tmp \\ + > ${params.additional_filename_prefix}bin-assembly-summaries.tsv + + else + + printf "There were no bins recovered.\\n" \\ + > ${params.additional_filename_prefix}bin-assembly-summaries.tsv + + fi + bit-version |grep "Bioinformatics Tools"|sed -E 's/^\\s+//' > versions.txt + """ +} + + +// Runs checkm on a recovered bin +process CHECKM_ON_BIN { + + tag "Running checkm on a recovered bin if any..." + + input: + path(bin) + output: + path("bin-checkm-out.tsv"), emit: checkm_output + path("versions.txt"), emit: version + script: + """ + # Only running if there were bins recovered + if [ `find -L . -name '*fasta' | wc -l | sed 's/^ *//'` -gt 0 ]; then + + mkdir -p checkm-working-tmp/ + + if [ ${params.reduced_tree} == "True" ]; then + + checkm lineage_wf \\ + -f bin-checkm-out.tsv \\ + --tab_table \\ + -t ${task.cpus} \\ + --reduced_tree \\ + --pplacer_threads 1 \\ + -x fasta . checkm-out-tmp/ \\ + --tmpdir checkm-working-tmp/ + + else + + checkm lineage_wf \\ + -f bin-checkm-out.tsv \\ + --tab_table \\ + -t ${task.cpus} \\ + --pplacer_threads 1 \\ + -x fasta . checkm-out-tmp/ \\ + --tmpdir checkm-working-tmp/ + + fi + + else + + printf "There were no bins recovered, so checkm was not run.\\n" \\ + > bin-checkm-out.tsv + + fi + checkm | grep CheckM | head -n 1 | sed -E 's/.+(CheckM\\sv.+)\\s.+/\\1/' > versions.txt + """ +} + +// Combines the outputs of running checkm on every bin into one file +process COMBINE_CHECKM { + tag "Combining CheckM results for all recovered bins..." + label "bins" + + input: + path(checkm_output, stageAs: "?/*") + output: + path("${params.additional_filename_prefix}bins-checkm-out.tsv"), emit: checkm_output + path("versions.txt"), emit: version + script: + """ + [ -f temp-bins-checkm-out.tsv ] && rm -rf temp-bins-checkm-out.tsv + + for bin_file in ${checkm_output}; do + + cat \${bin_file} >> temp-bins-checkm-out.tsv + + done + + (grep "^Bin Id" temp-bins-checkm-out.tsv | sort -u; \\ + grep -v "^Bin Id" temp-bins-checkm-out.tsv | sort -uV) \\ + > ${params.additional_filename_prefix}bins-checkm-out.tsv + + checkm | grep CheckM | head -n 1 | sed -E 's/.+(CheckM\\sv.+)\\s.+/\\1/' > versions.txt + """ + +} + + + +process GENERATE_BINS_OVERVIEW_TABLE { + + tag "Generating an overall overview of the recovered bins..." + label "bins" + label "bit" + + input: + path(bin_assembly_summaries) + path(bins_checkm_results) + path(bins) + output: + path("${params.additional_filename_prefix}bins-overview${params.assay_suffix}.tsv") + + script: + """ + # Only running if there were bins recovered + if [ `find -L . -name '*.fasta' | wc -l | sed 's/^ *//'` -gt 0 ]; then + + # Making sure none of the intermediate files exist already + [ -f checkm-estimates.tmp ] && rm -rf checkm-estimates.tmp + [ -f checkm-estimates-with-headers.tmp ] && rm -rf checkm-estimates-with-headers.tmp + + for bin in `cut -f 1 ${bin_assembly_summaries} | tail -n +2` + do + + grep -w -m 1 "^\$bin" ${bins_checkm_results} | \\ + cut -f 12,13,14 >> checkm-estimates.tmp + + done + + # Adding header + cat <(printf "est. completeness\\test. redundancy\\test. strain heterogeneity\\n") \\ + checkm-estimates.tmp > checkm-estimates-with-headers.tmp + + # Combining + paste ${bin_assembly_summaries} checkm-estimates-with-headers.tmp \\ + > ${params.additional_filename_prefix}bins-overview${params.assay_suffix}.tsv + + else + + printf "There were no bins recovered.\\n" \\ + > ${params.additional_filename_prefix}bins-overview${params.assay_suffix}.tsv + + fi + """ +} + + +workflow summarize_bins { + + take: + binning_ch + + main: + bins = binning_ch.map{ sample_id, bins -> bins instanceof List ? bins.each{it}: bins }.flatten().collect() + ZIP_BINS(Channel.of("bin"), bins) + SUMMARIZE_BIN_ASSEMBLIES(bins) + bin_assembly_summaries_ch = SUMMARIZE_BIN_ASSEMBLIES.out.summary + + CHECKM_ON_BIN(bins.flatten()) + COMBINE_CHECKM(CHECKM_ON_BIN.out.checkm_output.collect()) + bins_checkm_results_ch = COMBINE_CHECKM.out.checkm_output + + table = GENERATE_BINS_OVERVIEW_TABLE(bin_assembly_summaries_ch, bins_checkm_results_ch, bins) + + software_versions_ch = Channel.empty() + ZIP_BINS.out.version | mix(software_versions_ch) | set{software_versions_ch} + SUMMARIZE_BIN_ASSEMBLIES.out.version | mix(software_versions_ch) | set{software_versions_ch} + CHECKM_ON_BIN.out.version | mix(software_versions_ch) | set{software_versions_ch} + COMBINE_CHECKM.out.version | mix(software_versions_ch) | set{software_versions_ch} + + emit: + bins_checkm_results = bins_checkm_results_ch + overview_table = table + versions = software_versions_ch +} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/zip_fasta.nf b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/zip_fasta.nf new file mode 100644 index 000000000..f1fc6a40a --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/modules/zip_fasta.nf @@ -0,0 +1,63 @@ +#!/usr/bin/env nextflow +nextflow.enable.dsl=2 + +process ZIP_FASTA { + + tag "Zipping up your ${TYPE}s..." + label "genelab" + + + input: + val(TYPE) + path(DIR) + + output: + path("*.zip"), emit: zip_files, optional: true + path("versions.txt"), emit: version + + script: + """ + function zip_sample() { + + local SAMPLE=\$1 + local TYPE=\$2 + + mkdir -p \${SAMPLE}-\${TYPE}s && \\ + cp -f \${SAMPLE}-\${TYPE}*.fasta \${SAMPLE}-\${TYPE}s && \\ + zip -r \${SAMPLE}-\${TYPE}s.zip \${SAMPLE}-\${TYPE}s + + } + + + export -f zip_sample + + if [ ${TYPE} == 'bin' ]; then + + WORKDIR=`pwd` + else + + WORKDIR=${DIR} + fi + + if [ `find -L \${WORKDIR} -name '*.fasta' | wc -l | sed 's/^ *//'` -gt 0 ]; then + + + if [ ${TYPE} == 'MAG' ]; then + + find -L \${WORKDIR} -name '*.fasta' | xargs -I {} cp {} . + + fi + + SAMPLES=(`ls -1 *.fasta | sed -E 's/(.+)-${TYPE}.*.fasta/\\1/g'`) + + for SAMPLE in \${SAMPLES[*]};do + + zip_sample \${SAMPLE} ${TYPE} + + done + + fi + GL-version | grep "GeneLab utils"| sed -E 's/^\\s+//' > versions.txt + """ + +} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/nextflow.config b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/nextflow.config new file mode 100644 index 000000000..3ea34bc93 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/nextflow.config @@ -0,0 +1,483 @@ +//******** Global parameters *****************// +params { + + // Input file + // a 3-column (single-end) or 4-column (paired-end) file + input_file = null + + /* Run assembly-based workflow, read-based, or both + (values need to be one of: "assembly-based", "read-based", or "both") + It runs both by default + */ + workflow = "both" + + assay_suffix = "_GLmetagenomics" + + // Additional prefix to add to output files that describe more than one sample (to make them unique compared to other datasets) + // leave as empty, i.e. "", if not wanted, include separator at end if adding one, e.g. "Swift1S_" + additional_filename_prefix = "" + + publishDir_mode = "link" // "copy", "link", "symlink" + + // Quality trimmed/filtered suffixes + filtered_R1_suffix = "_R1_filtered.fastq.gz" + filtered_R2_suffix = "_R2_filtered.fastq.gz" + filtered_suffix = "_filtered.fastq.gz" // If single-end + + //-------------------------- Directories ----------------------------------// + + // Raw reads directory (can be relative to workflow directory, or needs to be full path) + raw_reads_dir = "../Raw_Sequence_Data/" + // Output directories (all relative to processing directory, will be created) + fastqc_out_dir = "../FastQC_Outputs/" + filtered_reads_dir = "../Filtered_Sequence_Data/" + assembly_based_dir = "../Assembly-based_Processing/" + assemblies_dir = "../Assembly-based_Processing/assemblies/" + genes_dir = "../Assembly-based_Processing/predicted-genes/" + annotations_and_tax_dir = "../Assembly-based_Processing/annotations-and-taxonomy/" + mapping_dir = "../Assembly-based_Processing/read-mapping/" + combined_output_dir = "../Assembly-based_Processing/combined-outputs/" + bins_dir = "../Assembly-based_Processing/bins/" + MAGs_dir = "../Assembly-based_Processing/MAGs/" + read_based_dir = "../Read-based_Processing/" + genelab_dir = "../GeneLab/" + logs_dir = "../Logs/" + metadata_dir = "../Metadata/" + + //************************* Databases **********************************// + CAT_DB_LINK = "https://tbb.bio.uu.nl/bastiaan/CAT_prepare/CAT_prepare_20210107.tar.gz" + GTDBTK_LINK = "https://data.gtdb.ecogenomic.org/releases/release220/220.0/auxillary_files/gtdbtk_package/full_package/gtdbtk_r220_data.tar.gz" + cat_db = null // "/path/to/Reference_DBs/CAT_prepare_20210107/" + ko_db_dir = null // "/path/to/Reference_DBs/kofamscan_db/" + metaphlan_db_dir = null // "/path/to/Reference_DBs/metaphlan4-db/" + chocophlan_dir = null // "/path/to/Reference_DBs/humann3-db/chocophlan/" + uniref_dir = null // "/path/to/Reference_DBs/humann3-db/uniref/" + utilities_dir = null // "/path/to/Reference_DBs/humann3-db/utility_mapping/" + gtdbtk_db_dir = null // "/path/to/Reference_DBs/GTDB-tk-ref-db/" + + // Quality assessment parameters + swift_1S = false + adapters = "${projectDir}/config/bbtools_adapters.fa" + multiqc_config = "${projectDir}/config/multiqc.config" + + + // Assembly parameter + max_mem = 100e9 // 100GB + + // Binning parameter + reduced_tree = "True" + + // Annotation parameters + pileup_mem = "5g" // pileup.sh paramater for calculating contig coverage and depth + block_size = 4 // CAT blocksize + + //******************** CAT database directory strings ************************// + // The strings below will be added to the end of the "cat_db" parameter provided above + // cat taxonomy directory with cat_db path provided above + cat_taxonomy_dir = "2021-01-07_taxonomy/" + cat_db_sub_dir = "2021-01-07_CAT_database/" + + // MAG parameters + min_est_comp = 90 // Minimum estimated completeness + max_est_redund = 10 // Maximum estimated redundancy + max_est_strain_het = 50 // Maximum estimated strain heterogeneity + + /* + Scratch directory for gtdb-tk, if wanting to use disk space instead of RAM, can be memory intensive; + see https://ecogenomics.github.io/GTDBTk/faq.html#gtdb-tk-reaches-the-memory-limit-pplacer-crashes + leave empty if wanting to use memory, the default, put in quotes the path to a directory that + already exists if wanting to use disk space + */ + + use_gtdbtk_scratch_location = false + + + // Specify paths to existing conda environments + conda_genelab = null // "/path/to/envs/genelab-utils" + conda_qc = null // "/path/to/envs/qc" + conda_humann3 = null // "/path/to/envs/humann3" + conda_cat = null // "/path/to/envs/genelab-utils/envs/CAT" + conda_prodigal = null // "/path/to/envs/prodigal" + conda_metabat = null // "/path/to/envs/metabat" + conda_gtdbtk = null // "/path/to/envs/gtdbtk" + conda_kegg_decoder = null // "/path/to/envs/kegg_decoder" + conda_megahit = null // "/path/to/envs/megahit" + conda_bit = null // "/path/to/envs/bit" + conda_kofamscan = null // "/path/to/envs/kofamscan" + conda_mapping = null // "/path/to/envs/mapping" + conda_checkm = null // "/path/to/envs/checkm" + + accession = null // GLDS or OSD acession number for the data to be processed + // Pattern of files on OSDR for the GLDS_accession you want to process. + RawFilePattern = null // "_metaG", "_HRremoved" + errorStrategy = "terminate" // nextflow's error handling strategy + debug = false // should info about the parameters set by the user be shown when the workflow starts. +} + +// Setting the default container engine to singularity +params.containerEngine = "singularity" +// Conda shouldn't be used by default except when using conda-based profiles +params.use_conda = false + + + +/******************************************************************************************************* +*************************************** Workflow Profiles ********************************************** +********************************************************************************************************/ + +profiles { + + slurm { + process.executor = 'slurm' + } + + conda { + conda.enabled = true + params.use_conda = true + conda.channels = 'conda-forge,bioconda' + conda.cacheDir = 'conda/' // location of conda environments + conda.createTimeout = '2h' + } + + mamba { + conda.enabled = true + conda.useMamba = true + conda.channels = 'conda-forge,bioconda' + params.use_conda = true + conda.cacheDir = 'conda/' // location of conda environments + conda.createTimeout = '2h' + } + + singularity { + singularity.enabled = true + singularity.autoMounts = true + + /* Uncomment the line below if you'd like to set the cache directory here, + as setting it here takes precedence over setting the nextflow variable + NXF_SINGULARITY_CACHEDIR=singularity/ in your run script + */ + //singularity.cacheDir = "singularity/" // location of singularity images + params.containerEngine = "singularity" + } + + docker { + docker.enabled = true + docker.runOptions = '-u $(id -u):$(id -g)' + params.containerEngine = "docker" + } + +} + +// Maximum number of jobs to submit in parallel +executor.queueSize = 20 + +/* + Root directory where the databases will be downloaded if they don't exist. + This should be provided as a full path (starting with '/'). + Note that relative paths such as '~/' and '../' are not expanded + by nextflow's evaluation of files, so don't use thosee. +*/ +params.DB_ROOT = "${launchDir.getParent()}/Reference_DBs" + +// Mount Humann databases to their predefined locations in the Biobakery container being used +if(params.chocophlan_dir == null || params.uniref_dir == null || params.metaphlan_db_dir == null || params.utilities_dir == null) { + + utilities = "${params.DB_ROOT}/humann3-db/utility_mapping/:/usr/local/lib/python3.6/dist-packages/humann/data/misc" + +}else{ + + utilities = "${params.utilities_dir}:/usr/local/lib/python3.6/dist-packages/humann/data/misc" +} + + +/****************************************************************************************************************** +***************** Tune process specific resources (cpu, container, memory etc.) *********************************** +*******************************************************************************************************************/ + +process { + + //******************* Default process settings ************************// + errorStrategy = { params.errorStrategy ? params.errorStrategy : "ignore"} + queue = "normal,priority" + maxRetries = 2 + memory = '5 GB' + cache = 'lenient' + cpus = 8 + + /********************************************************************************************* + ******************************** Process Specific Settings ********************************** + *********************************************************************************************/ + + //************************* Generic process labels used throughout the workflow ****************// + + withLabel: genelab { + + conda = {params.conda_genelab ? params.conda_genelab : "${projectDir}/envs/genelab.yaml"} + container = "olabiyi/genelab-utils:1.3.22" + } + + + withLabel: bit { + cpus = 2 + conda = {params.conda_bit ? params.conda_bit : "${projectDir}/envs/bit.yaml"} + container = "olabiyi/bit-astrobiomike:1.0" + memory = "5 GB" + } + +//*************************************** Database set-up ********************************************// + withLabel: humann_setup { + conda = {params.conda_humann3 ? params.conda_humann3 : "${projectDir}/envs/humann3.yaml"} + container = "biobakery/humann:3.9" + } + + withName: SETUP_METAPHLAN { + memory = "100 GB" + } + + + withLabel: db_setup { + storeDir = "${params.DB_ROOT}/" + } + + withName: SETUP_CAT_DB { + conda = {params.conda_cat ? params.conda_cat : "${projectDir}/envs/cat.yaml"} + container = "olabiyi/bit-astrobiomike:1.0" + } + + withName: SETUP_KOFAMSCAN_DB { + conda = {params.conda_kofamscan ? params.conda_kofamscan : "${projectDir}/envs/kofamscan.yaml"} + container = "olabiyi/bit-astrobiomike:1.0" + } + + withName: SETUP_GTDBTK_DB { + conda = {params.conda_gtdbtk ? params.conda_gtdbtk : "${projectDir}/envs/gtdb-tk.yaml"} + container = "quay.io/biocontainers/gtdbtk:2.4.0--pyhdfd78af_1" + } + +//************************* GLDS_accession runsheet and input file retrieval **************************************// + withName: GET_RUNSHEET { + cpus = 10 + conda = {params.conda_genelab ? params.conda_genelab : "${projectDir}/envs/genelab.yaml"} + container = "olabiyi/genelab-utils:1.3.22" + publishDir = [path: params.genelab_dir , mode: params.publishDir_mode] + } + +//********************************** Read quality control and assesment ********************************************// + withName: FASTQC { + conda = {params.conda_qc ? params.conda_qc : "${projectDir}/envs/qc.yaml"} + container = "staphb/fastqc:0.12.1" + cpus = 2 + publishDir = [path: params.raw_reads_dir, mode: params.publishDir_mode] + } + + withName: MULTIQC { + conda = {params.conda_qc ? params.conda_qc: "${projectDir}/envs/qc.yaml"} + container = "staphb/multiqc:1.19" + cpus = 2 + publishDir = [path: params.fastqc_out_dir, mode: params.publishDir_mode] + } + + withName: BBDUK { + conda = {params.conda_qc ? params.conda_qc: "${projectDir}/envs/qc.yaml"} + container = "staphb/bbtools:38.86" + cpus = 5 + memory = "40 GB" + publishDir = [[path: params.filtered_reads_dir, pattern: "*${params.filtered_suffix}" , mode: params.publishDir_mode], + [path: params.logs_dir, pattern: "*-bbduk.log" , mode: params.publishDir_mode]] + } + + +//************************************ Read-based processing *********************************************************// + + withLabel: read_based { + conda = {params.conda_humann3 ? params.conda_humann3 : "${projectDir}/envs/humann3.yaml"} + container = "biobakery/humann:3.9" + } + + + withLabel: read_based_outputs { + publishDir = [path: params.read_based_dir, mode: params.publishDir_mode] + } + + + withName: HUMANN { + cpus = 8 + memory = "100 GB" + } + + withName: GEN_READ_BASED_PROCESSING_KO_TABLE { + containerOptions = { params.containerEngine == "singularity" ? "-B ${utilities}" : "-v ${utilities}"} + } + + +//*************************************** Assembly-based proessing **************************************************// + + withLabel: assembly { + publishDir = [path: params.assemblies_dir, mode: params.publishDir_mode] + } + + withName: ASSEMBLE { + conda = {params.conda_megahit ? params.conda_megahit : "${projectDir}/envs/megahit.yaml"} + container = "biocontainers/megahit:1.2.9_cv1" + cpus = 8 + memory = "20 GB" + publishDir = [path: params.logs_dir, pattern: "*-assembly.log", mode: params.publishDir_mode] + } + + withName: RENAME_HEADERS{ + + publishDir = [path: params.assemblies_dir, pattern: "*-assembly.fasta" , mode: params.publishDir_mode] + + } + + + withLabel: mapping { + conda = {params.conda_mapping ? params.conda_mapping : "${projectDir}/envs/mapping.yaml"} + cpus = 8 + //errorStrategy = 'retry' + //maxRetries = 2 + memory = "20 GB" // {20.GB * task.attempt} + } + + withName: MAPPING { + container = "biocontainers/bowtie2:v2.4.1_cv1" + publishDir = [path: params.mapping_dir, pattern: "*-mapping-info.txt", mode: params.publishDir_mode] + } + + withName: SAM_TO_BAM { + container = "staphb/samtools:1.20" + publishDir = [path: params.mapping_dir, mode: params.publishDir_mode] + } + + withName: CALL_GENES { + conda = {params.conda_prodigal ? params.conda_prodigal : "${projectDir}/envs/prodigal.yaml"} + container = "quay.io/biocontainers/prodigal:2.6.3--h031d066_8" + cpus = 8 + publishDir = [path: params.genes_dir, pattern: "*-genes.gff", mode: params.publishDir_mode] + } + + withLabel: call_genes { + publishDir = [path: params.genes_dir, mode: params.publishDir_mode] + } + + withLabel: contig_annotation { + publishDir = [path: params.annotations_and_tax_dir, mode: params.publishDir_mode] + } + + withName: KO_ANNOTATION { + conda = {params.conda_kofamscan ? params.conda_kofamscan : "${projectDir}/envs/kofamscan.yaml"} + container = "quay.io/biocontainers/kofamscan:1.3.0--hdfd78af_2" + cpus = 8 + memory = "10 GB" + disk = "20 GB" + } + + withName: TAX_CLASSIFICATION { + conda = {params.conda_cat ? params.conda_cat : "${projectDir}/envs/cat.yaml"} + container = "nanozoo/catbat:5.2.3--e9c0a44" + cpus = 8 + memory = "50 GB" + disk = "100 GB" + } + + withName: GET_COV_AND_DET { + conda = {params.conda_mapping ? params.conda_mapping : "${projectDir}/envs/mapping.yaml"} + container = "staphb/bbtools:38.86" + cpus = 8 + memory = "20 GB" + publishDir = [path: params.mapping_dir, mode: params.publishDir_mode] + } + + withLabel: combine_outputs { + publishDir = [path: params.combined_output_dir, mode: params.publishDir_mode] + } + + + withName: METABAT_BINNING { + conda = {params.conda_metabat ? params.conda_metabat : "${projectDir}/envs/metabat.yaml"} + container = "nanozoo/metabat2:2.15--c1941c7" + cpus = 8 + publishDir = [path: params.mapping_dir, mode: params.publishDir_mode, pattern: "*-metabat-assembly-depth.tsv"] + } + + withLabel: bins { + publishDir = [path: params.bins_dir, mode: params.publishDir_mode] + } + + withName: ZIP_BINS { + publishDir = [path: params.bins_dir, mode: params.publishDir_mode] + } + + withName: "CHECKM_ON_BIN|COMBINE_CHECKM" { + conda = {params.conda_checkm ? params.conda_checkm : "${projectDir}/envs/checkm.yaml"} + container = "nanozoo/checkm:1.1.3--c79a047" + cpus = 8 + memory = "50 GB" + disk = "50 GB" + } + + withLabel: mags { + publishDir = [path: params.MAGs_dir, mode: params.publishDir_mode] + } + + withName: ZIP_MAGS { + publishDir = [path: params.MAGs_dir, mode: params.publishDir_mode] + } + + + withName: GTDBTK_ON_MAGS { + conda = {params.conda_gtdbtk ? params.conda_gtdbtk : "${projectDir}/envs/gtdb-tk.yaml"} + container = "quay.io/biocontainers/gtdbtk:2.4.0--pyhdfd78af_1" + containerOptions = { params.containerEngine == "singularity" ? "-B \${PWD}:/data -B ${gtdbtk_db_dir}:/refdata" : "-v \${PWD}:/data -v ${gtdbtk_db_dir}:/refdata" } + cpus = 8 + memory = "600 GB" + disk = "700 GB" + } + + withName: SUMMARIZE_MAG_KO_ANNOTS_WITH_KEGG_DECODER { + conda = {params.conda_kegg_decoder ? params.conda_kegg_decoder : "${projectDir}/envs/keggdecoder.yaml"} + container = "fmalmeida/keggdecoder:latest" + cpus = 8 + } + + withName: GENERATE_ASSEMBLY_PROCESSING_OVERVIEW_TABLE { + publishDir = [path: params.assembly_based_dir, mode: params.publishDir_mode] + } + +} + + +/***************************************************************************** +********************** Workflow Resource Usage Capturing ********************* +******************************************************************************/ + +// Adapted from : https://github.com/nf-core/rnaseq/blob/master/nextflow.config +def trace_timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss') +timeline { + enabled = true + file = "../Resource_Usage/execution_timeline_${trace_timestamp}.html" +} +report { + enabled = true + file = "../Resource_Usage/execution_report_${trace_timestamp}.html" +} +trace { + enabled = true + file = "../Resource_Usage/execution_trace_${trace_timestamp}.txt" +} + + + +/****************************************************************************** +**************************** Workflow Metadata ******************************** +*******************************************************************************/ + +manifest { + author = 'Olabiyi Aderemi Obayomi, Mike Douglas Lee' + homePage = 'https://github.com/nasa/GeneLab_Data_Processing/blob/master/Metagenomics/' + description = 'Metagenomics workflow for pipeline document GL-DPPD-7107-A' + mainScript = 'main.nf' + defaultBranch = 'main' + nextflowVersion = '>=24.04.4' + version = '1.0.0' +} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/post_processing.config b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/post_processing.config new file mode 100644 index 000000000..77be4dd73 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/post_processing.config @@ -0,0 +1,185 @@ +//******** Global parameters *****************// +params { + publishDir_mode = "link" // "copy", "link", "symlink" + //-------- Parmeters used to generate README.txt ------------------// + name = "FirstName M. LastName" // name of analyst + email = "name@nasa.gov" // email of analyst + protocol_id = "GL-DPPD-7107-A" // Genelab pipeline document protocol id followed + GLDS_accession = null // e.g. "GLDS-574" //or any string + OSD_accession = null // e.g. "OSD-574" or any string + assay_suffix = "_GLmetagenomics" + readme = "README${params.assay_suffix}.txt" + + + /* extra parameters and arguments to GL-gen-processed-metagenomics-data-readme command. + run `bin/GL-gen-processed-metagenomics-readme --help` for extra parameters that can be set + "--raw-reads-dir '../Raw_Sequence_Data/' " for Metagenomics + + */ + readme_extra = "" + + output_prefix = "" + V_V_guidelines_link = "https://genelab-tools.arc.nasa.gov/confluence/pages/viewpage.action?pageId=8225175" + + + // processing_zip_file and the files in it + processing_zip_file = "processing_info${params.assay_suffix}.zip" + runsheet_basename = null // "GLfile.csv" or "PE_file.csv" // only the base name is required here + runsheet = null // "../GeneLab/GLfile.csv" //or "PE_file.csv" // actual path (absolute or relative) is required here + logs_dir_basename = "Logs/" // base directory name of directory containing sample logs from processing - should always end with '/' + logs_dir = "../Logs/" // actual path (absolute or relative) is required here + // A comma separated list of file basenames to find in processing_info.zip + target_files = "command.txt,nextflow_processing_info_GLmetagenomics.txt,unique-sample-IDs.txt,software_versions.txt,${params.runsheet_basename},${params.logs_dir_basename}" + + + // Suffixes + raw_suffix = "_HRremoved_raw.fastq.gz" + raw_R1_suffix = "_R1_HRremoved_raw.fastq.gz" + raw_R2_suffix = "_R2_HRremoved_raw.fastq.gz" + filtered_suffix = "_filtered.fastq.gz" + filtered_R1_suffix = "_R1_filtered.fastq.gz" + filtered_R2_suffix = "_R2_filtered.fastq.gz" + + /* Extra parameters and arguments to GL-validate-processed-metagenomics-data command + run `bin/GL-validate-processed-metagenomics-data --help` for extra parameters that can be set + "--single-ended" if data are single-ended + "--R1-used-as-single-ended-data" if processing only R1 reads as single-end + */ + validation_extra = "--skip_raw_multiqc" + + /* Extra parameters and arguments to GL-gen-metagenomics-file-associations-table command + run `bin/GL-gen-metagenomics-file-associations-table --help` for extra parameters that can be set + "--single-ended" if data are single-ended + "--R1-used-as-single-ended-data" if processing only R1 reads as single-end + */ + file_association_extra = "--use-sample-names-from-assay-table" + + + // --------------------------- files --------------------------------- // + run_command = "./processing_scripts/command.txt" + processing_commands = "./processing_scripts/nextflow_processing_info_GLmetagenomics.txt" + samples = "./unique-sample-IDs.txt" + // You only need to supply one of assay_table or isa_zip + // If you supply both it will use only the assay_table + assay_table = null //"../GeneLab/a_OSD-574_metagenomic-sequencing_whole-genome-shotgun-sequencing_illumina.txt" + isa_zip = null //"../GeneLab/OSD-574_metadata_OSD-574-ISA.zip" + + software_versions = "../Metadata/software_versions.txt" + + + //------------------------------ Directories -------------------------------------// + // Make sure you always end the directory names with a forward slash "/" and that if you use + // relative paths, they are located in the run directory (./) or in its parent (../) + Raw_Sequence_Data = "../Raw_Sequence_Data" + FastQC_Outputs = "../FastQC_Outputs/" + Read_Based_Processing = "../Read-based_Processing/" + Filtered_Sequence_Data = "../Filtered_Sequence_Data/" + Assembly_Based_Processing = "../Assembly-based_Processing/" + Assemblies = "../Assembly-based_Processing/assemblies/" + Genes = "../Assembly-based_Processing/predicted-genes/" + Annotations_And_Tax = "../Assembly-based_Processing/annotations-and-taxonomy/" + Mapping = "../Assembly-based_Processing/read-mapping/" + Combined_Output = "../Assembly-based_Processing/combined-outputs/" + Bins = "../Assembly-based_Processing/bins/" + MAGS = "../Assembly-based_Processing/MAGs/" + Output_dir = "../Post_Processing/" + + + //Specify paths to existing conda environments + // Leave as is if you'd like to create a new conda environment + conda_genelab = null // "/path/to/envs/genelab-utils" + + debug = false // set to true if you'd like to see the parameters values printed to the terminal +} + + +params.baseDir = "${launchDir}" +parent_dir = "${launchDir.getParent()}" +// Setting the default container engine as singularity +params.containerEngine = "singularity" +// Conda shouldn't be used be default except when using conda-based profiles +// i.e., slurm_conda and conda +params.use_conda = false + + +/*************************************************************************************** +******************************** Workflow Profiles ************************************ +****************************************************************************************/ +profiles { + slurm { + process.executor = 'slurm' + } + + conda { + conda.enabled = true + params.use_conda = true + conda.channels = 'conda-forge,bioconda' + conda.cacheDir = 'conda/' // location of conda environments + conda.createTimeout = '2h' + } + + mamba { + conda.enabled = true + conda.useMamba = true + conda.channels = 'conda-forge,bioconda' + params.use_conda = true + conda.cacheDir = 'conda/' // location of conda environments + conda.createTimeout = '2h' + } + + singularity { + singularity.enabled = true + singularity.autoMounts = true + + /* Uncomment the line below if you'd like to set the cache directory here, + as setting it here takes precedence over setting the nextflow variable + NXF_SINGULARITY_CACHEDIR=singularity/ in your run script + */ + //singularity.cacheDir = "singularity/" // local singularity images location + params.containerEngine = "singularity" + } + + docker { + docker.enabled = true + docker.runOptions = '-u $(id -u):$(id -g)' + params.containerEngine = "docker" + } +} + +// Maximum number of jobs to submit in parallel +executor.queueSize = 20 + +/************************************************************************************ +*********** Tune process specific resources (cpu, container, memory etc.) *********** +*************************************************************************************/ +process { + //******************* Default process settings ************************// + errorStrategy = "ignore" + cpus = 2 + memory = '5 GB' + cache = 'lenient' + conda = {params.conda_genelab ? params.conda_genelab : "${projectDir}/envs/genelab.yaml"} + container = "olabiyi/genelab-utils:1.3.22" + publishDir = [path: params.Output_dir, mode: params.publishDir_mode] + + + // Mount Parent directory for processes that copy files + withName: "PACKAGE_PROCESSING_INFO|GENERATE_MD5SUMS" { + + containerOptions = { params.containerEngine == "singularity" ? "-B ${parent_dir}" : "-v ${parent_dir}:${parent_dir}" } + } +} + + +/****************************************************************************** +**************************** Workflow Metadata ******************************** +*******************************************************************************/ +manifest { + author = 'Olabiyi Aderemi Obayomi' + homePage = 'https://github.com/nasa/GeneLab_Data_Processing/blob/master/Metagenomics/' + description = 'Metagenomics Illumina post-processing workflow' + mainScript = 'post_processing.nf' + defaultBranch = 'main' + nextflowVersion = '>=24.04.4' + version = '1.0.0' +} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/post_processing.nf b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/post_processing.nf new file mode 100644 index 000000000..18eb16ca3 --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/post_processing.nf @@ -0,0 +1,346 @@ +#!/usr/bin/env nextflow +nextflow.enable.dsl=2 + +// Terminal text color definitions +c_back_bright_red = "\u001b[41;1m"; +c_bright_green = "\u001b[32;1m"; +c_blue = "\033[0;34m"; +c_reset = "\033[0m"; + +params.help = false + + +/************************************************** +* HELP MENU ************************************** +**************************************************/ +if(params.help){ + + println() + println("GeneLab Post Processing Pipeline: $workflow.manifest.version") + println("USAGE:") + println("Example: Submit and run jobs with slurm in singularity containers.") + println(" > nextflow -C post_processing.config run post_processing.nf -resume -profile slurm,singularity") + println() + println("Required Parameters:") + println("""-profile [STRING] Specifies the profile to be used to run the workflow. Options are [slurm, singularity, docker, and conda]. + singularity, docker and conda will run the workflow locally using singularity, docker, and conda, respectively. + To combine profiles, separate two or more profiles with a comma. + For example, to combine slurm and singularity profiles, pass 'slurm,singularity' as argument. """) + println(" --publishDir_mode [STRING] Specifies how nextflow handles output file publishing. Options can be found here https://www.nextflow.io/docs/latest/process.html#publishdir Default: link.") + println(" --GLDS_accession [STRING] A Genelab GLDS accession number. Example GLDS-574. Default: empty string") + println(" --OSD_accession [STRING] A Genelab OSD accession number. Example OSD-574. Default: empty string") + println(" --name [STRING] The analyst's full name. E.g. 'FirstName A. LastName'. Default: FirstName A. LastName") + println(" --email [STRING] The analyst's email address. E.g. 'mail@nasa.gov'. Default: mail@nasa.gov") + println(" --logs_dir_basename [STRING] Base directory name of directory containing per sample logs from processing - should always end with '/'. E.g. 'Logs/'. Default: Logs/") + println(" --runsheet_basename [String] The runsheets base name. Example 'GLfile.csv' or 'PE_file.csv'. Default: null") + println(" --assay_suffix [STRING] Genelab's assay suffix. Default: _GLmetagenomics.") + println(" --output_prefix [STRING] Unique name to tag onto output files. Default: empty string.") + println(" --V_V_guidelines_link [URL] Genelab metagenomics data validation and verification guidelines link. Default: https://genelab-tools.arc.nasa.gov/confluence/pages/viewpage.action?pageId=8225175.") + println(" --target_files [STRING] A comma separated list of target files and/or directories to find in processing_info.zip. Default: main.nf,nextflow.config,unique-sample-IDs.txt,envs/,bin/,config/,modules/,<--logs>.") + println("File Suffixes:") + println(" --raw_suffix [STRING] Suffix used for the raw reads during processing. Only applicable when input reads are single-end. Default: _HRremoved_raw.fastq.gz.") + println(" --raw_R1_suffix [STRING] Suffix used for the raw forward reads during processing. Default: _R1_HRremoved_raw.fastq.gz.") + println(" --raw_R2_suffix [STRING] Suffix used for the raw reverse reads during processing. Default: _R2_HRremoved_raw.fastq.gz.") + + println(" --filtered_suffix [STRING] Suffix used for quality filtered reads during processing. Only applicable when input reads are single-end. Default: _filtered.fastq.gz.") + println(" --filtered_R1_suffix [STRING] Suffix to use for quality filtered forward reads during processing. Default: _R1_filtered.fastq.gz.") + println(" --filtered_R2_suffix [STRING] Suffix to use for quality filtered reverse reads during processing. Default: _R2_filtered.fastq.gz.") + println() + println("Extra parameters to scripts:") + println(" --readme_extra [STRING] Extra parameters and arguments to GL-gen-processed-metagenomics-data-readme command. Run 'GL-gen-processed-metagenomics-readme --help' for extra parameters that can be set. Example '--raw-reads-dir ../Raw_Sequence_Data/'. Default: empty string") + println(" --validation_extra [STRING] Extra parameters and arguments to GL-validate-processed-metagenomics-data command. Run 'GL-validate-processed-metagenomics-data --help' for extra parameters that can be set. Example '--single-ended --R1-used-as-single-ended-data --skip_raw_multiqc'. Default: '--skip_raw_multiqc' ") + println(" --file_association_extra [STRING] Extra parameters and arguments to GL-gen-metagenomics-file-associations-table command. Run 'GL-gen-metagenomics-file-associations-table --help' for extra parameters that can be set. Example '--single-ended --R1-used-as-single-ended-data'. Default: '--use-sample-names-from-assay-table' ") + println() + println("Files:") + println(" --run_command [PATH] File containing the nextflow run command used in processing. Default: ./processing_scripts/command.txt") + println(" --processing_commands [PATH] File containing all the process names and scripts used during processing. Default: ./processing_scripts/nextflow_processing_info_GLAmpliseq.txt") + println(" --samples [PATH] A single column file with sample ids on each line generated after running the processing pipeline. Default: ./unique-sample-IDs.txt") + println(" --assay_table [PATH] GLDS assay table generated after running the processing pipeline with accession number as input.") + println(" Example, ../Genelab/a_OSD-574_metagenomic-sequencing_whole-genome-shotgun-sequencing_illumina.txt. Default: empty string") + println(" --isa_zip [PATH] Genelab ISA zip files containing an assay atable for the OSD accession. This is only required if --files.assay_table is not set.") + println(" Example, ../Genelab/OSD-574_metadata_OSD-574-ISA.zip. Default: empty string") + println(" --runsheet [PATH] A 3-column (single-end) or 4-column (paired-end) input file (sample_id, forward, [reverse,] paired) used to run the processing pipeline. This is the value set to the paremater --input_file when run the processing pipeline with a csv file as input otherwise it is the GLfile.csv in the GeneLab directory if --GLDS_accession was used as input. Example '../GeneLab/GLfile.csv'. Default: null") + + + println(" --software_versions [PATH] A file generated after running the processing pipeline listing the software versions used. Default: ../Metadata/software_versions.txt") + println() + println("Directories:") + println(" --logs_dir [PATH] Full or relative path to directory name of directory containing per sample logs from processing - should always end with '/'. E.g. 'Logs/'. Default: Logs/") + println(" --Raw_Sequence_Data [PATH] A directory containing raw sequence and raw sequence outputs. Default: ../Raw_Sequence_Data/") + println(" --FastQC_Outputs [PATH] A directory containing fastqc and multiqc zip reports. Default: ../FastQC_Outputs/") + println(" --Filtered_Sequence_Data [PATH] A directory containing the outputs of read filtering after running the processing pipeline. Default: ../Filtered_Sequence_Data/") + println(" --Read_based_Processing [PATH] A directory containing the outputs of read based processing after running the processing pipeline. Default: ../Read_based_Processing/") + println(" --Assembly_based_Processing [PATH] A directory containing the outputs of assembly based processing after running the processing pipeline. Default: ../Assembly_based_Processing/") + println(" --Assemblies [PATH] A directory containing sample contig assemblies after running the processing pipeline. Default: ../Assembly_based_Processing/assemblies/") + println(" --Genes [PATH] A directory containing sample predicted genes after running the processing pipeline. Default: ../Assembly_based_Processing/predicted-genes/") + println(" --Annotations_And_Tax [PATH] A directory containing sample gene and contig annotations after running the processing pipeline. Default: ../Assembly_based_Processing/annotations-and-taxonomy/") + println(" --Mapping [PATH] A directory containing sample read mapping (bam) files after running the processing pipeline. Default: ../Assembly_based_Processing/read-mapping/") + println(" --Combined_Output [PATH] A directory containing assembly summaries and reports across samples after running the processing pipeline. Default: ../Assembly_based_Processing/combined-outputs/") + println(" --Bins [PATH] A directory containing metagenome bins after running the processing pipeline. Default: ../Assembly_based_Processing/bins/") + println(" --MAGS [PATH] A directory containing metagenome assembled genomes (MAGS) after running the processing pipeline. Default: ../Assembly_based_Processing/MAGs/") + println(" --Output_dir [PATH] Specifies the directory where outputs of this post-processing workflow will be published. Default: ../Post_Processing/") + println() + println("Optional arguments:") + println(" --help [BOOLEAN] Print this help message and exit") + println(" --debug [BOOLEAN] Set to true if you'd like to see the values of your set parameters printed to the terminal. Default: false.") + println() + println("Paths to existing conda environments to use otherwise a new one will be created using the yaml file in envs/.") + println(" --conda_genelab [PATH] Path to a conda environment containing genelab-utils. Default: null.") + exit 0 +} + + +/************************************************ +*********** Show pipeline parameters ************ +*************************************************/ +if(params.debug){ + +log.info """${c_blue} + GeneLab Post Processing Pipeline: $workflow.manifest.version + + You have set the following parameters: + Profile: ${workflow.profile} + Analyst's Name: ${params.name} + Analyst's Email: ${params.email} + GLDS Accession: ${params.GLDS_accession} + OSD Accession: ${params.OSD_accession} + Assay Suffix: ${params.assay_suffix} + Output Prefix: ${params.output_prefix} + V & V Link: ${params.V_V_guidelines_link} + Target Files: ${params.target_files} + Nextflow Directory publishing mode: ${params.publishDir_mode} + + Base Names: + Run sheet: ${params.runsheet_basename} + Log Directory: ${params.logs_dir_basename} + + Suffixes: + Raw Suffix: ${params.raw_suffix} + Raw R1 suffix: ${params.raw_R1_suffix} + Raw R2 suffix: ${params.raw_R2_suffix} + Filtered Suffix: ${params.filtered_suffix} + Filtered R1 suffix: ${params.filtered_R1_suffix} + Filtered R2 suffix: ${params.filtered_R2_suffix} + + Extra scripts parameters: + Readme Script Extra: ${params.readme_extra} + Validation Script Extra: ${params.validation_extra} + File association Script Extra: ${params.file_association_extra} + + Files: + Nextflow Command: ${params.run_command} + Processing Commands: ${params.processing_commands} + Samples: ${params.samples} + Assay Table: ${params.assay_table} + ISA Zip: ${params.isa_zip} + Input Runsheet: ${params.runsheet} + Software Versions: ${params.software_versions} + + Directories: + Logs directory: ${params.logs_dir} + Raw Reads Directory: ${params.Raw_Sequence_Data} + Filtered Sequence Data: ${params.Filtered_Sequence_Data} + FastQC Outputs: ${params.FastQC_Outputs} + Read-based Processing: ${params.Read_based_Processing} + Assemblies: ${params.Assemblies} + Genes: ${params.Genes} + Annotations And Taxonomy: ${params.Annotations_And_Tax} + Mapping: ${params.Mapping} + Combined Output: ${params.Combined_Output} + Bins: ${params.Bins} + MAGS: ${params.MAGS} + Pipeline Outputs: ${params.Output_dir} + """ + +} + + +include { CLEAN_FASTQC_PATHS; PACKAGE_PROCESSING_INFO; GENERATE_README; VALIDATE_PROCESSING; + GENERATE_CURATION_TABLE; GENERATE_MD5SUMS; GENERATE_PROTOCOL} from './modules/genelab.nf' + +workflow { + + // Make sure accession numbers are set + if(!params.GLDS_accession || !params.OSD_accession){ + error("""${c_back_bright_red}ACCESSION ERROR!. + Please supply both --GLDS_accession and --OSD_accession. + They can be any string you choose but they must be set. + ${c_reset}""") + } + + + // ---------------------- Input channels -------------------------------- // + // Input files + sample_ids_file = Channel.fromPath(params.samples, checkIfExists: true) + software_versions = Channel.fromPath(params.software_versions, checkIfExists: true) + + // Directories + Bins = Channel.fromPath(params.Bins, type: 'dir', checkIfExists: true) + MAGS = Channel.fromPath(params.MAGS, type: 'dir', checkIfExists: true) + + // Input Value channels + OSD_ch = Channel.of([params.name, params.email, params.output_prefix, + params.OSD_accession, params.protocol_id, + params.FastQC_Outputs, + params.Filtered_Sequence_Data, + params.Read_Based_Processing, + params.Assembly_Based_Processing, + params.Assemblies, + params.Genes, + params.Annotations_And_Tax, + params.Mapping, + params.Combined_Output]) + + GLDS_ch = Channel.of([params.GLDS_accession, params.V_V_guidelines_link, params.output_prefix, + params.target_files, params.assay_suffix, params.logs_dir_basename, + params.raw_suffix, params.raw_R1_suffix, params.raw_R2_suffix, + params.filtered_suffix, params.filtered_R1_suffix, params.filtered_R2_suffix]) + + suffix_ch = Channel.of([params.GLDS_accession, params.output_prefix, params.assay_suffix, + params.raw_suffix, params.raw_R1_suffix, params.raw_R2_suffix, + params.filtered_suffix, params.filtered_R1_suffix, params.filtered_R2_suffix]) + + file_label_ch = Channel.of([params.processing_zip_file, params.readme]) + + // processed as paths but utilized as labels in the genberate curation association table script + dir_label_ch = Channel.of([params.Raw_Sequence_Data, + params.Filtered_Sequence_Data, + params.Read_Based_Processing, + params.Assembly_Based_Processing, + params.Annotations_And_Tax, + params.Combined_Output]) + .collect() + .map{ Raw_Sequence_Data, Filtered_Sequence_Data, Read_Based_Processing, + Assembly_Based_Processing, Annotations_And_Tax, Combined_Output -> + tuple( file(Raw_Sequence_Data, checkIfExists: true), + file(Filtered_Sequence_Data, checkIfExists: true), + file(Read_Based_Processing, checkIfExists: true), + file(Assembly_Based_Processing, checkIfExists: true), + file(Annotations_And_Tax, checkIfExists: true), + file(Combined_Output, checkIfExists: true) + ) + } + + // If the assay table is provided use it as the input table otherwise use the isa_zip + assay_table_ch = Channel.fromPath( params.assay_table ? params.assay_table : params.isa_zip, + checkIfExists: true) + + // Runsheet used to execute the processing workflow + runsheet_ch = Channel.fromPath(params.runsheet, checkIfExists: true) + + + + // Files and directories to be packaged in processing_info.zip + files_and_dirs_ch = Channel.of(params.logs_dir, params.run_command, params.processing_commands, + params.software_versions, params.runsheet, params.samples) + .collect() + .map{ logs, run_command, processing_commands, software_versions, runsheet, samples -> + tuple( file(logs, checkIfExists: true), + file(run_command, checkIfExists: true), + file(processing_commands, checkIfExists: true), + file(software_versions, checkIfExists: true), + file(runsheet, checkIfExists: true), + file(samples, checkIfExists: true) + ) } + + // ---------------------- Post-processing begins ---------------------------------// + PACKAGE_PROCESSING_INFO(files_and_dirs_ch) + + + GENERATE_README(OSD_ch, PACKAGE_PROCESSING_INFO.out.zip, Bins, MAGS) + + + FastQC_Outputs_dir = Channel.fromPath(params.FastQC_Outputs, type: 'dir', checkIfExists: true) + CLEAN_FASTQC_PATHS(FastQC_Outputs_dir) + + validation_dirs_ch = Channel.of(params.Filtered_Sequence_Data, + params.Read_Based_Processing, + params.Assembly_Based_Processing, + params.Assemblies, + params.Mapping, + params.Genes, + params.Annotations_And_Tax, + params.Bins, + params.MAGS, + params.Combined_Output) + .concat(CLEAN_FASTQC_PATHS.out.clean_dir) + .collect() + .map{ filtered_sequence, read_based, assembly_based, assemblies, + mapping, genes, annotation, bins, mags, combined_output, fastqc -> + tuple( file(filtered_sequence, checkIfExists: true), + file(read_based, checkIfExists: true), + file(assembly_based, checkIfExists: true), + file(assemblies, checkIfExists: true), + file(mapping, checkIfExists: true), + file(genes, checkIfExists: true), + file(annotation, checkIfExists: true), + file(bins, checkIfExists: true), + file(mags, checkIfExists: true), + file(combined_output, checkIfExists: true), + file(fastqc, checkIfExists: true) + ) } + + // Automatic verification and validation + VALIDATE_PROCESSING(GLDS_ch, validation_dirs_ch, + sample_ids_file, + GENERATE_README.out.readme, + PACKAGE_PROCESSING_INFO.out.zip) + + // Generate md5sums + dirs_ch = Channel.of(params.Read_Based_Processing, + params.Filtered_Sequence_Data, + params.Assembly_Based_Processing) + .concat(CLEAN_FASTQC_PATHS.out.clean_dir) + .collect() + .map{ read_based, filtered_sequence, assembly_based, fastqc -> + tuple( file(read_based, checkIfExists: true), + file(filtered_sequence, checkIfExists: true), + file(assembly_based, checkIfExists: true), + file(fastqc, checkIfExists: true) + ) } + + GENERATE_MD5SUMS(PACKAGE_PROCESSING_INFO.out.zip, + GENERATE_README.out.readme, dirs_ch) + + + // Generate curation file association table + curation_dirs_ch = Channel.of(params.Assemblies, + params.Genes, + params.Mapping, + params.Bins, + params.MAGS) + .concat(CLEAN_FASTQC_PATHS.out.clean_dir) + .collect() + .map{ assemblies, genes, mapping, bins, mags, fastqc -> + tuple( file(assemblies, checkIfExists: true), + file(genes, checkIfExists: true), + file(mapping, checkIfExists: true), + file(bins, checkIfExists: true), + file(mags, checkIfExists: true), + file(fastqc, checkIfExists: true) + ) } + + GENERATE_CURATION_TABLE(suffix_ch, file_label_ch, + dir_label_ch, + curation_dirs_ch, + assay_table_ch, runsheet_ch) + + + // Write methods + GENERATE_PROTOCOL(software_versions, params.protocol_id) +} + + +workflow.onComplete { + + println("${c_bright_green}Pipeline completed at: $workflow.complete") + println("""Execution status: ${ workflow.success ? 'OK' : "${c_back_bright_red}failed" }""") + log.info ( workflow.success ? "\nDone! Workflow completed without any error\n" : "Oops .. something went wrong${c_reset}" ) + + if ( workflow.success ) { + + println("Post-processing Outputs: ${params.Output_dir} ${c_reset}") + println() + + } +} diff --git a/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/slurm_submit.slurm b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/slurm_submit.slurm new file mode 100644 index 000000000..59c7fb82f --- /dev/null +++ b/Metagenomics/Illumina/Workflow_Documentation/NF_MGIllumina/workflow_code/slurm_submit.slurm @@ -0,0 +1,65 @@ +#!/bin/bash + +#SBATCH --job-name="nf_master" ## Replace job_name with the name of the job you are running ## +#SBATCH --output=nf_master.o.%j ## Replace job_name with the name of the job you are running ## +#SBATCH --error=nf_master.e.%j ## Replace job_name with the name of the job you are running ## +#SBATCH --partition=normal ## Specifies the job queue to use, for urgent jobs change normal to priority ## +#SBATCH --mem=10G ## Memory required to run the job in MB, this example is showing 10,000 MB or 10GB, change this number based on how much RAM you need ## +#SBATCH --cpus-per-task=1 ## Number of CPUs to run the job, this example is showing 5 CPUs, change this number based on how many CPUs you need ## +#SBATCH --mail-user=name@domain.com ## Specifies the e-mail address to e-mail when the job is complete, replace this e-mail address with your NASA e-mail address ## +#SBATCH --mail-type=END ## Tells slurm to e-mail the address above when the job has completed ## + +. ~/.profile + + +echo "nf_master" ## Replace job_name with the name of the job you are running ## +echo "" + + +## Add a time-stamp at the start of the job ## +start=$(date +%s) +echo "start time: $start" + +## Print the name of the compute node executing the job ## +echo $HOSTNAME + + +## Activate the conda environemnt containing the tools you need to run your job ## +## You can see a list of all available environments by running the command: conda env list ## + +source activate /path/to/envs/nextflow ## Replace conda_env_name with the name of the conda environment with nextflow installed ## + + +## Print the version of the tool you are using to ensure the tool version is recorded ## +echo "" +echo "Nextflow version: " ## Replace Tool with the name of the tool you are using ## +nextflow -v ## Replace this command with the command the tool uses to print its version ## +echo "" + + +## The command(s) that you want to run in this slurm job ## +export NXF_SINGULARITY_CACHEDIR=singularity/ +export TOWER_ACCESS_TOKEN= +export TOWER_WORKSPACE_ID= +#nextflow run main.nf -profile slurm,singularity -resume --csv_file PE_file.csv -with-tower ## Replace command with the command(s) you want to run ## +nextflow run main.nf -profile slurm,singularity --accession OSD-574 -resume -with-tower + + +## Add a time-stamp at the end of the job then calculate how long the job took to run in seconds, minutes, and hours ## +echo "" +end=$(date +%s) +echo "end time: $end" +runtime_s=$(echo $(( end - start ))) +echo "total run time(s): $runtime_s" +sec_per_min=60 +sec_per_hr=3600 +runtime_m=$(echo "scale=2; $runtime_s / $sec_per_min;" | bc) +echo "total run time(m): $runtime_m" +runtime_h=$(echo "scale=2; $runtime_s / $sec_per_hr;" | bc) +echo "total run time(h): $runtime_h" +echo "" + + +## Print the slurm job ID so you have it recorded and can view slurm job statistics if needed ## +echo "slurm job ID: ${SLURM_JOB_ID}" + diff --git a/Metagenomics/Illumina/Workflow_Documentation/README.md b/Metagenomics/Illumina/Workflow_Documentation/README.md index 468b5ca1b..28ddd29cf 100644 --- a/Metagenomics/Illumina/Workflow_Documentation/README.md +++ b/Metagenomics/Illumina/Workflow_Documentation/README.md @@ -4,10 +4,12 @@ ## MGIllumina Pipeline Version and Corresponding Workflow -|Pipeline Version|Current Workflow Version (for respective pipeline version)| -|:---------------|:---------------------------------------------------------| -|*[GL-DPPD-7107.md](../Pipeline_GL-DPPD-7107_Versions/GL-DPPD-7107.md)|[2.0.4](SW_MGIllumina)| +|Pipeline Version|Current Workflow Version (for respective pipeline version)|Nextflow Version| +|:---------------|:---------------------------------------------------------|:---------------| +|*[GL-DPPD-7107-A.md](../Pipeline_GL-DPPD-7107_Versions/GL-DPPD-7107-A.md)|[NF_MGIllumina_1.0.0](NF_MGIllumina)|24.04.4| +|[GL-DPPD-7107.md](../Pipeline_GL-DPPD-7107_Versions/GL-DPPD-7107.md)|[SW_MGIllumina_2.0.4](SW_MGIllumina)|N/A (Snakemake v7.26.0)| + *Current GeneLab Pipeline/Workflow Implementation -> See the [workflow change log](SW_MGIllumina/CHANGELOG.md) to access previous workflow versions and view all changes associated with each version update. +> See the [workflow change log](NF_MGIllumina/CHANGELOG.md) to access previous workflow versions and view all changes associated with each version update. diff --git a/Methyl-Seq/Pipeline_GL-DPPD-7113_Versions/GL-DPPD-7113.md b/Methyl-Seq/Pipeline_GL-DPPD-7113_Versions/GL-DPPD-7113.md index b3147b2cc..6720a327f 100644 --- a/Methyl-Seq/Pipeline_GL-DPPD-7113_Versions/GL-DPPD-7113.md +++ b/Methyl-Seq/Pipeline_GL-DPPD-7113_Versions/GL-DPPD-7113.md @@ -87,6 +87,7 @@ Samrawit Gebre (OSDR Project Manager) |Bioconductor | 3.20 |[https://bioconductor.org](https://bioconductor.org) |methylKit | 1.32.0 |[https://bioconductor.org/packages/release/bioc/html/methylKit.html](https://bioconductor.org/packages/release/bioc/html/methylKit.html)| |genomation | 1.38.0 |[https://bioconductor.org/packages/release/bioc/html/genomation.html](https://bioconductor.org/packages/release/bioc/html/genomation.html)| +|dp_tools | 1.3.4 |[https://github.com/J-81/dp_tools](https://github.com/J-81/dp_tools)| --- @@ -1353,7 +1354,7 @@ compute_contrast_bases <- function(i) { # Make binary vector for treatment argument to methRead() curr_treatment_vec <- c() for (value in curr_sample_info_df$condition) { - if (value == curr_sample_info_df$condition[1]) { + if (value == curr_contrasts_vec[1]) { curr_treatment_vec <- c(curr_treatment_vec, 1) } else { curr_treatment_vec <- c(curr_treatment_vec, 0) @@ -1367,7 +1368,7 @@ compute_contrast_bases <- function(i) { methylKit::unite(reorganize( meth_obj, sample.ids = as.list(curr_samples_vec), - treatment = as.integer(factor(curr_sample_info_df$condition)) - 1 + treatment = curr_treatment_vec ), min.per.group = 1L), # Keep only bases with coverage in at least one sample per group mc.cores = myargs$mc_cores) @@ -1489,7 +1490,44 @@ rm(df_list) ### 11f. Tile analysis ```R -### Tile analysis ### +### Function for computing differential methylation per tile for each contrasts ### +compute_contrast_tiles <- function(i) { + # Get current contrast + curr_contrasts_vec <- contrasts[, i] + + # Get subset sample info table relevant to current contrast + curr_sample_info_df <- sample_meth_info_df %>% filter(condition %in% curr_contrasts_vec) + + # Get which samples are relevant to current contrast + curr_samples_vec <- curr_sample_info_df %>% pull(sample_id) + + # Make binary vector for treatment argument to methRead() + curr_treatment_vec <- c() + for (value in curr_sample_info_df$condition) { + if (value == curr_contrasts_vec[1]) { + curr_treatment_vec <- c(curr_treatment_vec, 1) + } else { + curr_treatment_vec <- c(curr_treatment_vec, 0) + } + } + + # return methylation statistics for tiles + return( + as.data.frame(getData( + calculateDiffMeth( + methylKit::unite(reorganize( + meth_tiles_obj, + sample.ids = as.list(curr_samples_vec), + treatment = curr_treatment_vec + ), + min.per.group = 1L), # Keep only tiles with coverage in at least one sample per group + mc.cores = myargs$mc_cores) + ) + ) %>% + relocate("meth.diff", .before = "pvalue") %>% # move methyl diff value before stats values + rename_with(~ paste0(.x, "_", colnames(contrasts)[i]), any_of(c("pvalue", "qvalue", "meth.diff"))) + ) +} # Group bases into tiles meth_tiles_obj <- tileMethylCounts(norm_meth_obj,