AddGene plasmids for assignment

[manulera]

Hi @BjornFJohansson @hiyama341 @dgruano. As we discussed today, it would be nice to have an assigment where students can try to replicate a published cloning strategy using SYC or pydna. We said that as an excercise we would take 3 plasmids from AddGene and see if we can reproduce the cloning they mention in the paper. The good thing of AddGene plasmids is that then we can align them with what the student produced and see if they match.

[dgruano]

Hi there!

While exploring AddGene, I realized that the sequences from AddGene plasmids come from either sequencing or assemblies performed by AddGene as part of their QC pipeline. This of course makes a lot of sense for such a service!

In the frame of this exercise, would you say it is enough to characterize provenance up to the oldest plasmid documented by AddGene?

However, from the point of view of sequence provenance, is it enough? Or even further, if my lab got a plasmid X from another lab (which is not documented), should we refer to AddGene as the source of the sequence?.

And also, @manulera, should SYC take this into account when designing a strategy using AddGene as a source? I can imagine something like a checkbox to indicate that you purchased the plasmid (or strain) from the official repository that documented it. Alternatively, the ideal scenario is that the new lab sequences the plasmid and incorporates that experimental data as proof.

These may appear as some random thoughts, sorry for that.

Cheers!

Dani

[manulera]

What I did

Went to the Bacterial expression site:

https://www.addgene.org/collections/bacterial-expression/

Looked at the "Visualization and Tagging" section, went through those 3 papers but could not reproduce.

Then paper 4, I could reproduce 4 plasmids. Perhaps it's good to focus on labs that seem to document well their papers. This lab in particular listed primers even in other publications.

Paper 1

https://pubmed.ncbi.nlm.nih.gov/15696158/
https://www.addgene.org/browse/article/1215/

• The paper evolves the plasmid, so it would not have been possible, but even the initial plasmid is not sufficiently described:

The parental ECFP-YFP caspase substrate was constructed by gene assembly23. Oligonucleotides for the assembly of the ECFP (F64L, S65T, Y66W, N146I, M153T, V163A) variant included 5′ flanking _Sac_I and _Sfi_I restriction sites and replacement of the stop codon with a linker region encoding GGSGS and a _Kpn_I restriction site. Genes encoding a caspase-3 cleavage site (DEVD) and YFP (S65G, S72A, K79R, T203Y)1 were amplified together using gene assembly. The 5′ end of the YFP gene included a _Kpn_I restriction site, bases encoding the caspase-3 site, an _Avr_II restriction site and a GSGGS-encoding linker. _Sfi_I and _Sph_I restriction sites were added at the 3′-end of the YFP gene. The ECFP and linker-YFP gene products were cut and ligated together at the _Kpn_I sites and inserted between the _Sac_I and _Sph_I sites of pBAD33 (ref. 24), resulting in the pB33CCY plasmid. YFP (S65G, S72A, K79R, T203Y) was used as a starting point for directed evolution, since it possessed a higher extinction coefficient (94.54 × 103 M−1 cm−1) than other YFPs known upon the initiation of this work.

Paper 2

https://www.addgene.org/browse/article/2459/
https://pubmed.ncbi.nlm.nih.gov/19169260/

• Primers for mutagenesis missing.

All fluorescent proteins were inserted into the pRSETA vector (Invitrogen) using BamHI and EcoRI (tEos, dEos, mEos made by George Patterson, NIH). tdEos was made from dEos first by removing the natural HindIII site and replacing the stop codon with glycine. Next a PCR produced second copy of dEos with a 12 amino acid linker between EcoRI and HindIII was inserted into the same vector. Mutagenesis to generate new mEos mutants was performed by Kunkel mutagenesis11. Colonies were screened on a fluorescence dissecting scope (Olympus). Interesting mutants were picked, grown, plasmid isolated and sequenced (Janelia Farm Molecular Biology Shared Resource). For protein overexpression, plasmid was transformed into BL21(DE3)pLysS (Novagen), plated, colonies picked and grown to 0.6OD in 400mL 2YT growth media with antibiotics, shaking at 37C. Cultures were then induced with 1mM IPTG and moved to room temperature shaking for 24-48 hrs. Pellets were harvested, frozen at -20C overnight or longer, and thawed. They were then resuspended in IMAC A buffer (100mM NaxHxPO4 pH 7.4, 1M NaCl) with 1mg/mL lysozyme (Sigma Aldrich) and incubated on ice for at least 30 min. The suspension was sonicated and centrifuged at 8000g for 10 minutes. The supernatant was spun again at 35,000g for ~1 hr before being filtered and loaded onto an IMAC (GE Healthcare) column loaded with NiCl2. Gradient purification was performed using the BioLogic LP (BioRad) with elution buffer (IMAC A plus 300mM imidazole); fluorescent fractions were pooled and buffer exchanged with Amicon Ultra centrifuge membranes into PBS (Millipore).

Paper 3

https://www.addgene.org/browse/article/28192043/
https://www.ncbi.nlm.nih.gov/pubmed/29320486

Primer of mutagenesis missing

• Template sequences not specifically indicated.
• Missing primers

All experiments and cloning were performed with Escherichia coli MG1655 (The Coli Genetic Stock Center, Yale University; CGSC 6300). All avGFP derivatives were constructed from an initial mGFPmut2 template used to generate linear fragments of dsDNA with the appropriate point mutations at the 5′ and 3′ ends. Linear fragments (from one to six fragments, depending on the FP) and the backbone were assembled together in a single isothermal assembly reaction21. The backbone confers kanamycin resistance and harbors the low-copy origin SC101. FP expression was controlled by a member of a set of constitutive promoters, proC22, the T7 RBS and the T1 terminator. The mNeonGreen gene was a gift from J. Paulsson (Department of Systems Biology, HMS, Harvard University). All red FP genes were ordered as gBlocks from Integrated DNA Technologies (IDT) and cloned into a similar backbone as the one used for avGFPs. All FP coding sequences were confirmed by Sanger DNA sequencing from two clones. See Supplementary Note for the coding sequence definition of all FPs.
P__lacZ reporters with FPs of interest were cloned into the chromosome using the λ-Red homologous recombination system23. FPs were controlled by an RBS designed by Ishida and Oshima24. The RBS is a strong RBS and leaves the lacI binding site O1 and its context intact (Supplementary Fig. 17). There is a kanamycin cassette as selection marker located downstream of the FP gene. The sequences used as homologies for the integration were 5′AATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCA and 5′TTAAATAGTACATAATGGATTTCCTTACGCGAAATACGGGCAGACATGGC.

Paper 4

https://www.addgene.org/browse/article/464/
https://www.ncbi.nlm.nih.gov/pubmed/16322578

Could reproduce:

• IglC plasmid
• pDEST-peri-HisMBP
• GST–IglC
• His6MBP–IglC

Could not reproduce:

• RNaseA plasmid: Missing sequence of cDNA of RNaseA, sequence from PMID:7479688 (tried copying the figure seq but did not work)

Attached are cloning strategies as json files, and tsv file with the primers

excercise_cloning_history.zip

Gateway destination vectors
Gateway recombinational cloning (Invitrogen) was used to facilitate the construction of fusion protein expression vectors. The construction of a Gateway destination vector for the production of MBP fusion proteins (pKM596) was described previously (Fox and Waugh 2003). The cytoplasmic His6MBP destination vector (pDEST-HisMBP) was constructed by inserting an in frame hexahistidine sequence between codons three and four of the open reading frame (ORF) encoding MBP in pKM596, as detailed elsewhere (Tropea et al. 2005).
The periplasmic His-MBP expression vector (pDEST-peri-HisMBP) was assembled as follows. In one PCR, the nucleotide sequence encoding the N-terminal signal peptide of MBP and a portion of the plasmid backbone extending into the lacI gene was amplified from the plasmid expression vector pMal-P2 (Riggs 2000) with the primers PE-1436 (5′-CTTCGTG ATGGTGATGGTGATGGATTTTGGCGAGAGCCGAG GCGGAAAAC-3′) and PE-1437 (5′-TCTCCCATGAAGAC GGTACGCGACTG-3′). This resulted in the addition of a sequence encoding a hexahistidine tag two codons after the natural signal peptidase cleavage site. In a second PCR, a portion of the ORF encoding MBP and its N-terminal hexahistidine tag was amplified from pDEST-HisMBP with the primers PE-1435 (5′-GTTTTCCGCCTCGGCTCTCGCCAAAATCCAT CACCATCACCATCACGAAG-3′) and PE-1438 (5′-CTCTT ACCTTTCGCTTTCAGTTC-3′). Next, the amplicons from these two PCRs were combined and used as the template for a third PCR with primers PE-1437 and PE-1438. The final PCR amplicon was digested with BstEII and BglII, and then inserted between the BstEII and BglII sites in pDEST-HisMBP to generate pDEST-periHisMBP. The nucleotide sequence of the insert was confirmed experimentally.

Gateway entry clones
The ORF encoding IglC was amplified by PCR, using the following oligodeoxyribonucleotide primers: 5′-GAGAACCTG TACTTCCAGATGATTATGAGTGAGATGATAACAAG-3′ (PE-1656) and 5′-GGGGACCACTTTGTACAAGAAAGCTG GGATTATGCAGCTGCAATATATCCTATTTTA G-3′ (PE-1657). The template for this PCR was genomic DNA from F. tularensis obtained from the United States Military Institute of Infectious Diseases (USAMRIID). Next, the resulting PCR amplicon was used as the template for another PCR with primers PE-277 (Evdokimov et al. 2002) and PE-1657. The former primer is designed to anneal to the sequence encoding the TEV protease recognition site and add an attB1 recombination site to the end of the amplicon. The final PCR amplicon was inserted into pDONR201 (Invitrogen) by recombinational cloning to generate the entry clone pSN1751. The nucleotide sequence of the ORF encoding IglC was verified experimentally.
The ORF encoding RNaseA was amplified by PCR, using the following deoxyribonucleotide primers: 5′-GAGAACCTGTAC TTCCAGGGTAAAGAGACAGCAGCCGCAAAGTTTG-3′ (PE-1384) and 5′-ATTAGTGATGATGGTGGTGATGAAC ACTGGCGTCAAAGTGGACAGGAAC-3′ (PE-1385). The template for this PCR reaction was a cDNA clone (pRR16) of bovine RNaseA obtained from Dr. Ronald Raines (DelCardayré et al. 1995). Next, this PCR amplicon was used as the template for another PCR with primers PE-277 and PE-278 (Evdokimov et al. 2002), which are designed to anneal to the sequences encoding the TEV protease recognition site and the His-tag, respectively, and add attB1 and attB2 recombination sites to the ends of the amplicon. The final PCR amplicon was inserted into pDONR201 (Invitrogen) by recombinational cloning to generate the entry clone pSN1430. The nucleotide sequence of the ORF encoding RNaseA was verified experimentally.

Fusion protein expression vectors
The His6MBP–IglC (pKP1690) and GST–IglC (pSN1752) fusion protein expression vectors were constructed by recombining the IglC ORF from pKP1690 into the destination vectors pDEST-HisMBP and pDEST-15 (Invitrogen), respectively. Cytosolic (pSN1432) and periplasmic(pSN1554) His6MBP–RnaseA fusion protein expression vectors were constructed by recombining the RNaseA ORF from pSN1430 into the destination vectors pDEST-HisMBP and pDEST-periHisMBP, respectively. The His6MBP–RNaseA fusion proteins have an identical interdomain linker sequence consisting of the translation product of the attB1 recombination site followed by a TEV protease recognition site (ITSLYKKAGSENLYFQG). The GST–RNaseA fusion protein expression vector (pSN1431) was constructed by recombining the RNaseA ORF from pSN1430 into the destination vector pDEST-15. MBP-p16, MBP-E6, and MBP-GFP fusion proteinexpression vectors were constructed by recombining the passenger protein ORFs from pre-existing entry clones (Fox et al. 2003) into pKM596. The corresponding His6MBP fusion protein expression vectors were constructed by recombining the ORFs from these entry clones into pDEST-HisMBP (Fox and Waugh 2003).

[manulera]

@BjornFJohansson @dgruano @hiyama341 I did my part! Ball's on your court!

I did not verify that the sequence is the same, because not all plasmids cloned in the paper were deposited in AddGene, but I was able to reproduce 3 plasmids. I think that could count for the assignment. Took me a while I have to say

[dgruano]

Hi all!

Here are my four plasmids. Unfortunately, I could not reproduce any of them,

The first one, I found it navigating to the AddGene Browse page, going to Curated Collections, clicking on Bacterial Expression, and it was the first plasmid in the table (pCas9)

The other three I took them from the top results of the Bluesky Addgene account, which publishes a "plasmid of the day" every day.

Plasmid 1

https://www.addgene.org/12876/
https://pmc.ncbi.nlm.nih.gov/articles/PMC3748948/

Existing information:

• Primers used for amplificatin of S. pyogenes sequences
• Strain of S. pyogenes used
• cloning_strategy.json

Missing information

• Backbone plasmid sequence (pZE21)
• Origin of cloramphenicol resistance cassette
• Cloning reaction

The activation of CRISPR interference through the chromosomal integration of a CRISPR-Cas system is only possible in organisms that are highly recombinogenic. To develop a more general method that is applicable to other microbes, we decided to perform CRISPR-assisted genome editing in E. coli using a plasmid-based CRISPR-Cas system. Two plasmids were constructed: a pCas9 plasmid carrying the tracrRNA, Cas9 and a chloramphenicol resistance cassette (Supplementary fig. 9), and a pCRISPR kanamycin-resistant plasmid carrying the array of CRISPR spacers.

The pCas9 plasmid was constructed as follow. Essential CRISPR elements were amplified from Streptococcos pyogenes SF370 genomic DNA with flanking homology arms for Gibson Assembly. The tracrRNA and Cas9 were amplified with oligos HC008 and HC010. The leader and CRISPR sequences were amplified HC011/HC014 and HC015/HC009, so that two BsaI type IIS sites were introduced in between two direct repeats to facilitate easy insertion of spacers.

pCRISPR was constructed by subcloning the pCas9 CRISPR array in pZE21-MCS1 through amplification with oligos B298+B299 and restriction with EcoRI and BamHI. The rpsL targeting spacer was cloned by annealing of oligos B352+B353 and cloning in the BsaI cut pCRISPR giving pCRISPR::rpsL.

Supplementary Fig. 9
pCas9 carries chloramphenicol
resistance (CmR) and is based on the low-copy pACYC184 plasmid backbone. pCRISPR is
based on the high-copy number pZE21 plasmid. Two plasmids are required because a pCRISPR
plasmid containing a spacer targeting the E. coli chromosome cannot be constructed using this
organism as a cloning host if Cas9 is also present (it will kill the host).

Plasmid 2

According to the supplementary table 1, the information on this plasmid is:

Name: pLX208-nfBFP
Insert: untagged nfBFP
Description: Untagged, nonfluorescent BFP[H66A]
Vector pLX208 Lentivirus
Promoters: Ef1α:nfBFP; PGK:Neomycin phosphotransferase

No information is provided on the construction of this or other plasmids. They are provided “as is”

Plasmid 3

https://www.addgene.org/198801/
https://pmc.ncbi.nlm.nih.gov/articles/PMC10743456/

Could not reproduce. Despite what’s noted on the materials section, I have not found information on “promoters, primers and vectors” in the “SI Appendix Supplemental Methods”. Existing information:

• Backbones used: pHW393, pAH36, and pAH37
• Cloning reaction used:
  • FseI and AscI digestion ligation
  • Gibson Assembly for trx-1

Missing information:

• Sources of backbones
• PCR primers used
• Whether restriction sites are added by PCR

Molecular Biology.
Sequences were obtained from WormBase (5). Plasmids were constructed using standard molecular techniques, with all promoters amplified from genomic N2 DNA by PCR. Vector backbones used in this study include pHW393, pAH36, and pAH37. Regulatory sequences, except for trx-1, were digested with FseI and AscI and inserted into the respective expression vector using T4 ligase (trx-1 was inserted into pHW393 using Gibson assembly). Further details on the promoters, primers, and vectors used can be found in SI Appendix, Supplemental Methods.

Plasmid 4

https://www.addgene.org/126822/
https://pmc.ncbi.nlm.nih.gov/articles/PMC6969409/

Could not reproduce. Missing critical information:

• What antigens
• What N-linked glycosilation sites
• What codon used for Ser/Thr mutation to Ala
• Specific information on the codon optimisation (i imagine they synthesize a g-block of the desired genes)
• Explicit cloning method

Recombinant protein construct design, expression and manipulation
The orthologues of immunoreactive blood-stage antigens from P. knowlesi, P. malariae and P. ovale were identified from their respective genome sequences [22–24]. For P. ovale, proteins from Plasmodium ovale curtisi were selected since the manual gene annotation of this genome resulted in complete open reading frames compared to the draft genome available for Plasmodium ovale wallikeri [24]. Sequences corresponding to the entire ectodomains were identified using software tools to predict the location of the signal peptides, GPI-anchor and transmembrane regions [25, 26]. In some cases, for example, P. malariae P38, this analysis helped improve automated gene prediction by identifying missing signal peptides. Based on these predictions, the ectodomain regions were determined by removing signal sequences and transmembrane domains. All potential N-linked glycosylation sites were systematically mutated by substituting the serine/threonine in the context of an N-linked glycosylation sequon for alanine to prevent inappropriate glycosylation when expressed in mammalian cells as described previously [16]. All sequences were codon-optimized for expression in human cells, flanked with unique 5′ NotI and 3′ AscI restriction enzyme sites to allow inframe cloning in a plasmid containing a highly efficient mouse variable κ light chain signal peptide [27] and a rat Cd4d3+ 4 epitope tag followed by either a peptide sequence allowing enzymatic biotinylation and/or 6-his tag for purification [28].