feat: Add sanity check to indexed FASTA file

src/main/java/htsjdk/samtools/reference/AbstractIndexedFastaSequenceFile.java

@@ -31,6 +31,7 @@
 import htsjdk.samtools.SAMSequenceRecord;
 import htsjdk.samtools.util.IOUtil;
 
+import java.io.File;
 import java.io.FileNotFoundException;
 import java.io.IOException;
 import java.nio.ByteBuffer;
@@ -146,6 +147,41 @@ protected static void sanityCheckDictionaryAgainstIndex(final String fastaFile,
         }
     }
 
+    /** Do some basic checking to make sure the fasta and the index match.
+     * <p>
+     * checks that the length of the fasta file is at least as long as the index proclaims
+     * and that beyond the last position references in the index there is only one line followed by whitespaces
+     *
+     * @param fastaFile Used for error reporting only.
+     * @param index index file to check against the dictionary.
+     */
+    public static void sanityCheckFastaAgainstIndex(final String fastaFile,
+                                                    final FastaSequenceIndex FastaSequenceIndex) {
+
+
+        final Iterator<FastaSequenceIndexEntry> iterator = FastaSequenceIndex.iterator();
+        FastaSequenceIndexEntry fastaSequenceIndex = null;
+        while (iterator.hasNext()) {
+            fastaSequenceIndex = iterator.next();
+        }
+        assert fastaSequenceIndex != null;
+        final long lastSequenceLength = fastaSequenceIndex.getSize();
+        final long lastSequenceStart = fastaSequenceIndex.getLocation();
+        final long lastSequenceEnd = lastSequenceStart + fastaSequenceIndex.getOffset(lastSequenceLength);
+
+        final long fastaLength = new File(fastaFile).length();
+
+        //Question: should we worry about files with lots of whitespace in their end?
+        if (lastSequenceEnd > fastaLength) {
+            throw new IllegalArgumentException("The fasta file is shorter (%d) than its index claims (%d). Please reindex the fasta.".formatted(fastaLength, lastSequenceEnd));
+        }
+        // not sure why need to add 1 here.
+        if (lastSequenceEnd + fastaSequenceIndex.getTerminatorLength() + 1 < fastaLength) {
+            throw new IllegalArgumentException("The fasta file is too long (%d) given the claims of its index (%d). Please reindex the fasta.".formatted(fastaLength, lastSequenceEnd + fastaSequenceIndex.getTerminatorLength()));
+        }
+    }
+
+
     public FastaSequenceIndex getIndex() {
         return index;
     }
@@ -210,7 +246,8 @@ public ReferenceSequence getSubsequenceAt( String contig, long start, long stop
         final int bytesPerLine = indexEntry.getBytesPerLine();
         final int terminatorLength = bytesPerLine - basesPerLine;
 
-        long startOffset = ((start-1)/basesPerLine)*bytesPerLine + (start-1)%basesPerLine;
+        long startOffset = indexEntry.getOffset(start);
+
         // Cast to long so the second argument cannot overflow a signed integer.
         final long minBufferSize = Math.min((long) Defaults.NON_ZERO_BUFFER_SIZE, (long)(length / basesPerLine + 2) * (long)bytesPerLine);
         if (minBufferSize > Integer.MAX_VALUE) throw new SAMException("Buffer is too large: " +  minBufferSize);

src/main/java/htsjdk/samtools/reference/FastaSequenceIndexEntry.java

@@ -112,6 +112,26 @@ public int getSequenceIndex() {
         return sequenceIndex;
     }
 
+    /** Return the offset to pos as determined by the number of bases and bytes per line
+     *
+     * @param pos the (1-based) position in the contig that is requested
+     * @return the offset (0-based) from 'location' where pos is located in the file.
+     */
+    public long getOffset(long pos) {
+        final int basesPerLine = this.getBasesPerLine();
+        final int bytesPerLine = this.getBytesPerLine();
+
+        return ((pos - 1) / basesPerLine) * bytesPerLine + (pos - 1) % basesPerLine;
+    }
+
+    /** get the terminator length from the bytes per line and the bases per line
+     *
+     * @return the length of the terminator of each line (1 or 2)
+     */
+    public int getTerminatorLength() {
+        return bytesPerLine - basesPerLine;
+    }
+
     /**
      * For debugging.  Emit the contents of each contig line.
      * @return A string representation of the contig line.

src/main/java/htsjdk/samtools/reference/IndexedFastaSequenceFile.java

@@ -80,6 +80,7 @@ public IndexedFastaSequenceFile(final Path path, final FastaSequenceIndex index)
             if (IOUtil.isBlockCompressed(path, true)) {
                 throw new SAMException("Indexed block-compressed FASTA file cannot be handled: " + path);
             }
+            sanityCheckFastaAgainstIndex(path.toAbsolutePath().toString(),index);
             this.channel = Files.newByteChannel(path);
         } catch (IOException e) {
             throw new SAMException("FASTA file should be readable but is not: " + path, e);

src/test/java/htsjdk/samtools/reference/AbstractIndexedFastaSequenceFileTest.java

@@ -60,6 +60,10 @@ public class AbstractIndexedFastaSequenceFileTest extends HtsjdkTest {
     private static final File SEQUENCE_FILE_BGZ = new File(TEST_DATA_DIR,"Homo_sapiens_assembly18.trimmed.fasta.gz");
     private static final File SEQUENCE_FILE_GZI = new File(TEST_DATA_DIR,"Homo_sapiens_assembly18.trimmed.fasta.gz.gzi");
     private static final File SEQUENCE_FILE_NODICT = new File(TEST_DATA_DIR,"Homo_sapiens_assembly18.trimmed.nodict.fasta");
+    private static final Path HEADER_WITH_WHITESPACE = new File(TEST_DATA_DIR,"header_with_white_space.fasta").toPath();
+    private static final Path CRLF = new File(TEST_DATA_DIR,"crlf.fasta").toPath();
+    private static final Path HEADER_WITH_WHITESPACE_index = AbstractIndexedFastaSequenceFile.findFastaIndex(HEADER_WITH_WHITESPACE);
+    private static final Path CRLF_index = AbstractIndexedFastaSequenceFile.findFastaIndex(CRLF);
 
     private final String firstBasesOfChrM = "GATCACAGGTCTATCACCCT";
     private final String extendedBasesOfChrM = "GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCAT" +
@@ -68,6 +72,15 @@ public class AbstractIndexedFastaSequenceFileTest extends HtsjdkTest {
     private final String lastBasesOfChr20 = "ttgtctgatgctcatattgt";
     private final int CHR20_LENGTH = 1000000;
 
+    @DataProvider(name="mismatched_indexes")
+    public Object[][] provideMismatchedIndexes() {
+        return new Object[][]{
+                new Object[]{HEADER_WITH_WHITESPACE,CRLF_index},
+                new Object[]{CRLF,HEADER_WITH_WHITESPACE_index}
+        };
+    }
+
+
     @DataProvider(name="homosapiens")
     public Object[][] provideSequenceFile() throws FileNotFoundException {
         return new Object[][] { new Object[]
@@ -470,4 +483,13 @@ public void testBlockCompressedIndexedFastaSequenceFileFromNio() throws IOExcept
         }
     }
 
+    @Test(expectedExceptions = IllegalArgumentException.class,
+            dataProvider = "mismatched_indexes")
+    public void testWrongIndex(Path fasta, Path index){
+        try (IndexedFastaSequenceFile indexedFastaSequenceFile = new IndexedFastaSequenceFile(fasta, new FastaSequenceIndex(index))) {
+
+        } catch (IOException e) {
+            throw new RuntimeException(e);
+        }
+    }
 }