sprout.md

layout	title	permalink	header
page	Sprout	/SPROUT	image_fullwidth header_unsplash_1.jpg

<title>SPROUT</title>

SPROUT

SPROUT is a machine learning algorithm that predicts the DNA repair outcome in CRISPR-CAS9 experiments.
Click to access the source code.

Input the 20-nucleotide sgRNA sequence followed by the 3-nucleotide PAM sequence
(e.g., CCACCAAAGTACGATGTGAGAGG)

			<textarea type="text" name="inp" placeholder="Input sequence ..." class="form-control" style="width: 880px; height: 100px;"></textarea>
			<br>
			<p>Input: </p>
			<div class="share" style="width: 400px;">
				
			</div>
			<br>
			<p>Output: </p>
			<div class="share" style="width: 400px;">
				
				
				
			</div>
			<br>
			<input type="submit" value="Predict" class="btn btn-primary" style="width: 150px;" />
		</form>
	</div>
</div>