Correcting H5 specific primer/probe asset names and adding 'dairyprod…

assets/DHO_CN_H5specific01_primers.fasta

@@ -0,0 +1,4 @@
+>DHO_CN_H5specific01_FORWARD
+GGGAAGCTATGCGACCTAAAT
+>DHO_CN_H5specific01_REVERSE
+CATTCCGGCACTCTGATGAA

assets/DHO_CN_H5specific01_probe.fasta

@@ -0,0 +1,2 @@
+>DHO_CN_H5specific01_PROBE
+ACATTGGGTTTCCGAGGAGCCATC

assets/DHO_CN_H5specific03_primers.fasta

@@ -0,0 +1,4 @@
+>DHO_CN_H5specific03_FORWARD
+GAACCTTTACGACAAAGTCAGATTAC
+>DHO_CN_H5specific03_REVERSE
+GGGTAGTCATACGTCCCATTTC

assets/DHO_CN_H5specific03_probe.fasta

@@ -0,0 +1,2 @@
+>DHO_CN_H5specific03_PROBE
+AGGGATAATGCAAAGGAGCTGGGT

assets/proposal_template.tsv

@@ -1 +1 @@
-sample	carton	date_purchased	date_expiration	assay	average_cycle_threshold	average_copies_per_uL	primer_asset_file	probe_asset_file	RNA_extraction_method	positive_for_HPAI	processing_plant_state	SRA_bioproject	SRA_accession	contributors	date_contributed
+sample	carton	date_purchased	date_expiration	assay	average_cycle_threshold	isolate_average_copies_per_uL	dairyproduct_average_copies_per_mL	primer_asset_file	probe_asset_file	RNA_extraction_method	positive_for_HPAI	processing_plant_state	SRA_bioproject	SRA_accession	contributors	date_contributed

assets/still.schema

@@ -12,7 +12,8 @@ date_purchased: is_date() && is_date_format("[2020-02-10]")
 date_expiration: is_date() || is_missing() || is_empty()
 assay: any("qPCR", "dPCR", "other") || is_missing() || is_empty()
 average_cycle_threshold: is_numeric() || is_empty() || is_missing()
-average_copies_per_uL: is_numeric() || is_empty() || is_missing()
+isolate_average_copies_per_uL: is_numeric() || is_empty() || is_missing()
+dairyproduct_average_copies_per_mL: is_numeric() || is_empty() || is_missing()
 primer_asset_file: is('REDACTED') || is_string()
 probe_asset_file: is('REDACTED') || is_string()
 RNA_extraction_method: is_string() || is_empty() || is_missing()

docs/proposal_instructions.md

@@ -36,7 +36,9 @@ assay - The kind of assay used to determine whether a product was positive. Curr
 
 average_cycle_threshold - The cycle threshold value of the sample in a PCR-based assay. This is the number of cycles performed before a positive signal is detected by the instrument. Format as a number with decimal points. An example is "27.3". If the sample is negative, insert "NA".
 
-average_copies_per_uL - A calculated value of targets per uL of sample extract/isolate added to the assay reaction. This is not intended to be the concentration of the original milk sample. For qPCR, the average_copies_per_uL value should be calculated from the cycle threshold value compared to a standard curve. The copies per reaction value should then be divided by the number of uL of sample extract/isolate that was added to the reaction mix. This value is optional. Round to nearest whole number.
+isolate_average_copies_per_uL - A calculated value of targets per uL of sample extract/isolate added to the assay reaction. This is not intended to be the concentration of the original milk sample. For qPCR, the average_copies_per_uL value should be calculated from the cycle threshold value compared to a standard curve. The copies per reaction value should then be divided by the number of uL of sample extract/isolate that was added to the reaction mix. This value is optional. Round to nearest whole number.
+
+dairyproduct_average_copies_per_mL - A calculated value of targets per mL of original dairy product. Could be extrapolated from isolate_average_copies_per_ul with knowledge of your specific sample processing protocol. 
 
 **primer_asset_file** - The name of the file of the primers used in the assay. A file with the same name should be present in the [assets directory](../assets) of this repository. If this is your first time committing with your data you may need to add these files when you commit. The primer file should be a single fasta or bed file with both the forward and reverse primer. If your primers are proprietary, this field can be filled with "redacted" to indicate this. This filename should be unique among files within the repository. An example is "HPAI_primers.fasta".