Skip to content

giuferrero/mykrobe

 
 

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

Table of Contents generated with DocToc

Mykrobe

http://www.mykrobe.com

Requirements

  • python > 3.4
  • mongodb > 3.0 (optional)

Installation

pipenv (virtual environment)

To install mykrobe into a virtual environment (recommended) with pipenv, run the following

git clone https://github.com/Mykrobe-tools/mykrobe.git mykrobe
cd mykrobe

## Download pre-built probesets
wget -O mykrobe-data.tar.gz https://bit.ly/2H9HKTU && tar -zxvf mykrobe-data.tar.gz && rm -fr src/mykrobe/data && mv mykrobe-data src/mykrobe/data

pipenv install -e .  # install mykrobe in a new virtual environment
pipenv shell  # enter the virtual environment
mykrobe --help  # mykrobe should now be available on path

Bioconda

conda badge

Before attempting to install with bioconda, please ensure you have your channels set up as specified in the documentation. If you don't, you may run into issues with an older version of mykrobe being installed.

To install this package with conda in a dedicated environment:

conda install -c bioconda mykrobe

Containers

Biocontainers maintain images for all bioconda recipes. The container and all tags for mykrobe can be found here. To use a specific version, just select your required version/tag and use the URI as follows.

tag="0.7.0--py37h2666aa9_0"
uri="quay.io/biocontainers/mykrobe:${tag}"

# using Singularity
singularity exec docker://"$uri" mykrobe --help
# using docker
docker pull "$uri"

pip

git clone https://github.com/Mykrobe-tools/mykrobe.git mykrobe
cd mykrobe

## Download pre-built probesets
wget -O mykrobe-data.tar.gz https://bit.ly/2H9HKTU && tar -zxvf mykrobe-data.tar.gz && rm -fr src/mykrobe/data && mv mykrobe-data src/mykrobe/data

pip3 install .

Note: It is recommended you install inside a virtual environment. If you choose not to, you will need to run the pip3 install command with sudo. This is because it attempts to put some binaries inside /usr/local/bin if the installation is not being run from inside a virtual environment.

Usage

    mykrobe --help
    usage: mykrobe [-h] [--version]
                         {predict,panels,variants,vars,genotype} ...

    optional arguments:
      -h, --help            show this help message and exit
      --version             mykrobe version

    [sub-commands]:
      {predict,panels,variants,vars,genotype}
        predict             predict the sample's drug susceptibility
        panels              A description of the AMR panels available within
                            Mykrobe predict
        variants (vars)     build variant probes
        genotype            genotype a sample using a probe set

AMR prediction (Mykrobe predictor)

mykrobe predict --help
usage: mykrobe predict [-h] [-k kmer] [--tmp TMP] [--keep_tmp]
                         [--skeleton_dir SKELETON_DIR]
                         [--mccortex31_path MCCORTEX31_PATH] [-t THREADS]
                         [-m MEMORY] [--expected_depth EXPECTED_DEPTH]
                         [-1 seq [seq ...]] [-c ctx] [-f] [--ont]
                         [--guess_sequence_method] [--ignore_minor_calls]
                         [--ignore_filtered IGNORE_FILTERED]
                         [--model model] [--ploidy ploidy]
                         [--filters FILTERS [FILTERS ...]]
                         [--report_all_calls]
                         [--expected_error_rate EXPECTED_ERROR_RATE]
                         [--min_variant_conf MIN_VARIANT_CONF]
                         [--min_gene_conf MIN_GENE_CONF]
                         [--min_proportion_expected_depth MIN_PROPORTION_EXPECTED_DEPTH]
                         [--min_gene_percent_covg_threshold MIN_GENE_PERCENT_COVG_THRESHOLD]
                         [--output OUTPUT] [-q] [--panel panel]
                         [--custom_probe_set_path custom_probe_set_path]
                         [--custom_variant_to_resistance_json custom_variant_to_resistance_json]
                         [--min_depth min_depth]
                         [--conf_percent_cutoff conf_percent_cutoff]
                         [--format {json,csv}]
                         sample species

positional arguments:
  sample                sample id
  species               species

optional arguments:
  -h, --help            show this help message and exit
  -k kmer, --kmer kmer  kmer length (default:21)
  --tmp TMP             tmp directory (default: tmp/)
  --keep_tmp            Dont remove tmp files
  --skeleton_dir SKELETON_DIR
                        directory for skeleton binaries
  --mccortex31_path MCCORTEX31_PATH
                        Path to mccortex31. Default mccortex31
  -t THREADS, --threads THREADS
                        threads
  -m MEMORY, --memory MEMORY
                        memory for graph constuction
  --expected_depth EXPECTED_DEPTH
                        expected depth
  -1 seq [seq ...], --seq seq [seq ...]
                        sequence files (fasta,fastq,bam)
  -c ctx, --ctx ctx     cortex graph binary
  -f, --force           force
  --ont                 Set default for ONT data. Sets expected_error_rate to
                        0.15 and to haploid
  --guess_sequence_method
                        Guess if ONT or Illumia based on error rate. If error
                        rate is > 10%, ploidy is set to haploid and a
                        confidence threshold is used
  --ignore_minor_calls  Ignore minor calls when running resistance prediction
  --ignore_filtered IGNORE_FILTERED
                        don't include filtered genotypes
  --model model         Genotype model used, default kmer_count. Options
                        kmer_count, median_depth
  --ploidy ploidy       Use a diploid (includes 0/1 calls) or haploid
                        genotyping model
  --filters FILTERS [FILTERS ...]
                        don't include filtered genotypes
  --report_all_calls    report all calls
  --expected_error_rate EXPECTED_ERROR_RATE
                        Expected sequencing error rate. Set to 0.15 for ONT
                        genotyping.
  --min_variant_conf MIN_VARIANT_CONF
                        minimum genotype confidence for variant genotyping
  --min_gene_conf MIN_GENE_CONF
                        minimum genotype confidence for gene genotyping
  --min_proportion_expected_depth MIN_PROPORTION_EXPECTED_DEPTH
                        minimum depth required on the sum of both alleles.
                        Default 0.3 (30%)
  --min_gene_percent_covg_threshold MIN_GENE_PERCENT_COVG_THRESHOLD
                        all genes alleles found above this percent coverage
                        will be reported (default 100 (only best alleles
                        reported))
  --output OUTPUT       File path to save output json file as. Default is to
                        stdout.
  -q, --quiet           do not output warnings to stderr
  --panel panel         variant panel (default:201901). custom requires
                        custom_probe_set_path and
                        custom_variant_to_resistance_json to be set
  --custom_probe_set_path custom_probe_set_path
                        For use with `--panel custom`. File path to fasta file
                        from `mykrobe make-probes`.
  --custom_variant_to_resistance_json custom_variant_to_resistance_json
                        For use with `--panel custom`. File path to JSON with
                        key,value pairs of variant names and induced drug
                        resistance.
  --min_depth min_depth
                        min_depth
  --conf_percent_cutoff conf_percent_cutoff
                        Number between 0 and 100. Determines
                        --min_variant_conf, by simulating variants and
                        choosing the cutoff that would keep x% of the
                        variants. Default is 90 if --ont, otherwise
                        --min_variant_conf is used as the cutoff
  --format {json,csv}   Choose output format. Default: csv.

Examples

mykrobe predict tb_sample_id tb -1 tb_sequence.bam/fq --format json --output results.json
# send output to stdout instead
mykrobe predict staph_sample_id staph -1 staph_sequence.bam/fq > result.csv

Output

Output is in CSV by default. For a more detailed output use the JSON format with --format json.

{
    "sample_id": {
        "susceptibility": {
            "Rifampicin": {
                "predict": "S"
            },
            ...
            "Streptomycin": {
                "predict": "S"
            }
        "phylogenetics": {
            "lineage": {
                "Unknown": {
                    "percent_coverage": -1,
                    "median_depth": -1
                }
            },
            ...
            "species": {
                "Mycobacterium_tuberculosis": {
                    "percent_coverage": 98.0,
                    "median_depth": 53
                }
            }
        },  
        "typed_variants": {
            "rpoB_N438S-AAC761118AGT": {
                "info": {
                    "contamination_depths": [],
                    "coverage": {
                        "alternate": {
                            "percent_coverage": 47.62,
                            "median_depth": 0.0,
                            "min_depth": 0
                        },
                        "reference": {
                            "percent_coverage": 100.0,
                            "median_depth": 49.0,
                            "min_depth": 44.0
                        }
                    },
                    "expected_depths": [
                        56.0
                    ]
                },
                "_cls": "Call.VariantCall",
                "genotype": [
                    0,
                    0
                ],
                "genotype_likelihoods": [
                    -4.25684443365591,
                    -99999999.0,
                    -99999999.0
                ]
            },   ...               
        },          

Citing

If you use one of the following panels please cite the relevant publications:

mykrobe predict tb_sample_id  tb --panel walker-2015 -1 tb_sequence.bam

Walker, Timothy M., et al. "Whole-genome sequencing for prediction of Mycobacterium tuberculosis drug susceptibility and resistance: a retrospective cohort study." The Lancet Infectious Diseases 15.10 (2015): 1193-1202.

mykrobe predict tb_sample_id  tb --panel bradley-2015 -1 tb_sequence.bam

Bradley, Phelim, et al. "Rapid antibiotic-resistance predictions from genome sequence data for Staphylococcus aureus and Mycobacterium tuberculosis." Nature communications 6 (2015).

Genotyping a pre-built probe set

mykrobe genotype --help
usage: mykrobe genotype [-h] [-k kmer] [--tmp TMP] [--keep_tmp]
                              [--skeleton_dir SKELETON_DIR]
                              [--mccortex31_path MCCORTEX31_PATH] [-t THREADS]
                              [-m MEMORY] [--expected_depth EXPECTED_DEPTH]
                              [-1 seq [seq ...]] [-c ctx] [-f] [--ont]
                              [--guess_sequence_method] [--ignore_minor_calls]
                              [--ignore_filtered IGNORE_FILTERED]
                              [--model model] [--ploidy ploidy]
                              [--filters FILTERS [FILTERS ...]]
                              [--report_all_calls]
                              [--expected_error_rate EXPECTED_ERROR_RATE]
                              [--min_variant_conf MIN_VARIANT_CONF]
                              [--min_gene_conf MIN_GENE_CONF]
                              [--min_proportion_expected_depth MIN_PROPORTION_EXPECTED_DEPTH]
                              [--min_gene_percent_covg_threshold MIN_GENE_PERCENT_COVG_THRESHOLD]
                              [--output OUTPUT] [-q]
                              sample probe_set

positional arguments:
  sample                sample id
  probe_set             probe_set

optional arguments:
  -h, --help            show this help message and exit
  -k kmer, --kmer kmer  kmer length (default:21)
  --tmp TMP             tmp directory (default: tmp/)
  --keep_tmp            Dont remove tmp files
  --skeleton_dir SKELETON_DIR
                        directory for skeleton binaries
  --mccortex31_path MCCORTEX31_PATH
                        Path to mccortex31. Default mccortex31
  -t THREADS, --threads THREADS
                        threads
  -m MEMORY, --memory MEMORY
                        memory for graph constuction
  --expected_depth EXPECTED_DEPTH
                        expected depth
  -1 seq [seq ...], --seq seq [seq ...]
                        sequence files (fasta,fastq,bam)
  -c ctx, --ctx ctx     cortex graph binary
  -f, --force           force
  --ont                 Set demykrobe genotype --help
usage: mykrobe genotype [-h] [-k kmer] [--tmp TMP] [--keep_tmp]
                              [--skeleton_dir SKELETON_DIR]
                              [--mccortex31_path MCCORTEX31_PATH] [-t THREADS]
                              [-m MEMORY] [--expected_depth EXPECTED_DEPTH]
                              [-1 seq [seq ...]] [-c ctx] [-f] [--ont]
                              [--guess_sequence_method] [--ignore_minor_calls]
                              [--ignore_filtered IGNORE_FILTERED]
                              [--model model] [--ploidy ploidy]
                              [--filters FILTERS [FILTERS ...]]
                              [--report_all_calls]
                              [--expected_error_rate EXPECTED_ERROR_RATE]
                              [--min_variant_conf MIN_VARIANT_CONF]
                              [--min_gene_conf MIN_GENE_CONF]
                              [--min_proportion_expected_depth MIN_PROPORTION_EXPECTED_DEPTH]
                              [--min_gene_percent_covg_threshold MIN_GENE_PERCENT_COVG_THRESHOLD]
                              [--output OUTPUT] [-q]
                              sample probe_set

positional arguments:
  sample                sample id
  probe_set             probe_set

optional arguments:
  -h, --help            show this help message and exit
  -k kmer, --kmer kmer  kmer length (default:21)
  --tmp TMP             tmp directory (default: tmp/)
  --keep_tmp            Dont remove tmp files
  --skeleton_dir SKELETON_DIR
                        directory for skeleton binaries
  --mccortex31_path MCCORTEX31_PATH
                        Path to mccortex31. Default mccortex31
  -t THREADS, --threads THREADS
                        threads
  -m MEMORY, --memory MEMORY
                        memory for graph constuction
  --expected_depth EXPECTED_DEPTH
                        expected depth
  -1 seq [seq ...], --seq seq [seq ...]
                        sequence files (fasta,fastq,bam)
  -c ctx, --ctx ctx     cortex graph binary
  -f, --force           force
  --ont                 Set default for ONT data. Sets expected_error_rate to
                        0.15 and to haploid
  --guess_sequence_method
                        Guess if ONT or Illumia based on error rate. If error
                        rate is > 10%, ploidy is set to haploid and a
                        confidence threshold is used
  --ignore_minor_calls  Ignore minor calls when running resistance prediction
  --ignore_filtered IGNORE_FILTERED
                        don't include filtered genotypes
  --model model         Genotype model used, default kmer_count. Options
                        kmer_count, median_depth
  --ploidy ploidy       Use a diploid (includes 0/1 calls) or haploid
                        genotyping model
  --filters FILTERS [FILTERS ...]
                        don't include filtered genotypes
  --report_all_calls    report all calls
  --expected_error_rate EXPECTED_ERROR_RATE
                        Expected sequencing error rate. Set to 0.15 for ONT
                        genotyping.
  --min_variant_conf MIN_VARIANT_CONF
                        minimum genotype confidence for variant genotyping
  --min_gene_conf MIN_GENE_CONF
                        minimum genotype confidence for gene genotyping
  --min_proportion_expected_depth MIN_PROPORTION_EXPECTED_DEPTH
                        minimum depth required on the sum of both alleles.
                        Default 0.3 (30%)
  --min_gene_percent_covg_threshold MIN_GENE_PERCENT_COVG_THRESHOLD
                        all genes alleles found above this percent coverage
                        will be reported (default 100 (only best alleles
                        reported))
  --output OUTPUT       File path to save output json file as. Default is to
                        stdout.
  -q, --quiet           do not output warnings to stderrfault for ONT data. Sets expected_error_rate to
                        0.15 and to haploid
  --guess_sequence_method
                        Guess if ONT or Illumia based on error rate. If error
                        rate is > 10%, ploidy is set to haploid and a
                        confidence threshold is used
  --ignore_minor_calls  Ignore minor calls when running resistance prediction
  --ignore_filtered IGNORE_FILTERED
                        don't include filtered genotypes
  --model model         Genotype model used, default kmer_count. Options
                        kmer_count, median_depth
  --ploidy ploidy       Use a diploid (includes 0/1 calls) or haploid
                        genotyping model
  --filters FILTERS [FILTERS ...]
                        don't include filtered genotypes
  --report_all_calls    report all calls
  --expected_error_rate EXPECTED_ERROR_RATE
                        Expected sequencing error rate. Set to 0.15 for ONT
                        genotyping.
  --min_variant_conf MIN_VARIANT_CONF
                        minimum genotype confidence for variant genotyping
  --min_gene_conf MIN_GENE_CONF
                        minimum genotype confidence for gene genotyping
  --min_proportion_expected_depth MIN_PROPORTION_EXPECTED_DEPTH
                        minimum depth required on the sum of both alleles.
                        Default 0.3 (30%)
  --min_gene_percent_covg_threshold MIN_GENE_PERCENT_COVG_THRESHOLD
                        all genes alleles found above this percent coverage
                        will be reported (default 100 (only best alleles
                        reported))
  --output OUTPUT       File path to save output json file as. Default is to
                        stdout.
  -q, --quiet           do not output warnings to stderr

Examples

mykrobe genotype sample_id example-data/staph-amr-bradley_2015.fasta -1 seq.fq
{
    "sample_id": {
    "files": [
        "seq.fq "
    ],
    "kmer": 21,
    "sequence_calls": {
        "mecA": {
            "info": {
                "copy_number": 0.0,
                "contamination_depths": [],
                "coverage": {
                    "percent_coverage": 0.0,
                    "median_depth": 0.0,
                    "min_non_zero_depth": 0.0
                },
                "expected_depths": [
                    1
                ]
            },
            "_cls": "Call.SequenceCall",
            "genotype": [
                0,
                0
            ],
            "genotype_likelihoods": [
                -0.001,
                -99999999.0,
                -99999999.0
            ]
        },
        "fusA": {
            "info": {
                "copy_number": 1.0276923076923077,
                "contamination_depths": [],
                "version": "10",
                "coverage": {
                    "percent_coverage": 100.0,
                    "median_depth": 167.0,
                    "min_non_zero_depth": 116.0
                },
                "expected_depths": [
                    162.5
                ]
            },
            "_cls": "Call.SequenceCall",
            "genotype": [
                1,
                1
            ],
            "genotype_likelihoods": [
                -994.7978064088725,
                -349.45246450237215,
                -10.95808091830304
            ]
        },                     
    ....
}
}     

Make a custom probe set (for use with mykrobe genotype)

Add variants to the database (for background/context)

This is optional but will make any probe sets built more robust to variation in within k-1 bases of the key variants. This will require mongoDB > 3.0 running in the background.

usage: mykrobe variants add [-h] [--db_name db_name] [-f] [-q]
                                  [-m METHOD]
                                  vcf reference_set

positional arguments:
  vcf                   a vcf file
  reference_set         reference set

optional arguments:
  -h, --help            show this help message and exit
  --db_name db_name     db_name
  -f, --force           force
  -q, --quiet           do not output warnings to stderr
  -m METHOD, --method METHOD
                        variant caller method (e.g. CORTEX)

To add a VCF to the database db_name run

mykrobe variants add --db_name :db_name sample.vcf :reference

Use the --method argument to specify the variant caller or pipeline used (if you'll have multiple Call Sets per sample)

mykrobe variants add --db_name :db_name --method CORTEX sample_cortex.vcf :reference    

Make probes and dump-probes

    mykrobe variants make-probes --help
    usage: mykrobe variants make-probes [-h] [--db_name db_name] [-q]
                                              [-f VCF] [-v VARIANT] [-t TEXT_FILE]
                                              [-g GENBANK] [-k KMER]
                                              [--no-backgrounds]
                                              reference_filepath

    positional arguments:
      reference_filepath    reference_filepath

    optional arguments:
      -h, --help            show this help message and exit
      --db_name db_name     db_name
      -q, --quiet           do not output warnings to stderr
      -f VCF, --vcf VCF     Use variants defined in a VCF file
      -v VARIANT, --variant VARIANT
                            Variant in DNA positions e.g. A1234T
      -t TEXT_FILE, --text_file TEXT_FILE
                            Text file containing variants as rows A1234T
      -g GENBANK, --genbank GENBANK
                            Genbank file containing genes as features
      -k KMER, --kmer KMER  kmer length
      --no-backgrounds      Build probe set against reference only ignoring nearby
                            variants

Examples

1 Simple case - building a probe without using backgrounds

mykrobe variants make-probes -v A1234T example-data/NC_000962.3.fasta

2. 'Dumping' the Variant database

To build a ProbeSet of all non-singleton variants in the database run:

`mykrobe variants dump-probes`

usage: mykrobe dump-probes [-h] [--db_name db_name] [-q] [--kmer kmer] [--force]
                     [-v]
                     reference_filepath

positional arguments:
  reference_filepath  reference_filepath

optional arguments:
  -h, --help          show this help message and exit
  --db_name db_name   db_name
  -q, --quiet         do not output warnings to stderr
  --kmer kmer         kmer length
  --force
  -v, --verbose
mykrobe variants dump-probes reference_set.fasta > variant_probe_set.fasta

This will generate a probe set for each variant in the database. The resulting fasta file will look like the following:

     >ref-37d2eea6a23d526cbee4e00b901dc97885a88e7aa8721432b080dcc342b459ce?num_alts=10&ref=56cf2e4ca9fefcd2b15de4d6
    TCGCCGCAGCGGTTGGCAACGATGTGGTGCGATCGCTAAAGATCACCGGGCCGGCGGCACCAT
    ...
    TCGCCGCAGCGGTTGGCAACGATGTGGTGCAATCGCTAAAGATCACCGGGCCGGCGGCATCAT
    >alt-37d2eea6a23d526cbee4e00b901dc97885a88e7aa8721432b080dcc342b459ce
    TCGCCGCAGCGGTTGGCAACGATGTGGTGCAATCGCTAAAGATCACCGGGCCGGCGGCACGAT
    >ref-2dab6387a677ac17f6bc181f47235a4196885723b34ceff3a05ffcbfd6834347?num_alts=10&ref=56cf2e4ca9fefcd2b15de4d6
    CTGTCGCTGGGAAGAGCGAATACGTCTGGACCAGGACGGGCTACCCGAACACGATATCTTTCG
    >alt-2dab6387a677ac17f6bc181f47235a4196885723b34ceff3a05ffcbfd6834347
    ...

Where you have a series of variants represented as a set of alleles. The reference allele followed by multiple alternate alleles. You will end up with multiple alternate alleles if there are other variants that fall within k of the target variant.

Each variant is referenced by a var_hash with is the hash of ":ref:pos:alt" which is indexed in the database and can be used to query for Variant object.

See mykrobe genotype to use these probes to genotype a new sample.

3. Building a custom probe set

mykrobe variants make-probes allows you to build a probe set using Variants that are not already in the database but using the population variation to produce multiple alleles per variant.

     usage: mykrobe variants  make-probes [-h] [--db_name db_name] [-q] [-v VARIANT] [-f FILE]
                             [-g GENBANK] [-k KMER] [--no-backgrounds]
                             reference_filepath

    positional arguments:
      reference_filepath    reference_filepath

    optional arguments:
      -h, --help            show this help message and exit
      --db_name db_name     db_name
      -q, --quiet           do not output warnings to stderr
      -v VARIANT, --variant VARIANT
                            Variant in DNA positions e.g. A1234T
      -f FILE, --file FILE  File containing variants as rows A1234T
      -g GENBANK, --genbank GENBANK
                            Genbank file containing genes as features
      -k KMER, --kmer KMER  kmer length
      --no-backgrounds      Build probe set against reference only ignoring nearby
                            variants
Build a variant probe set defined based on reference co-ordinates (1-based)

First, define your variants for which you want to build probes. Columns are

ref/gene pos ref alt alphabet

    ref     2522798 G       T       DNA
    ref     3785555 A       G       DNA
    ref     839793  C       A       DNA
    ref     2734398 C       G       DNA
    ref     3230861 T       A       DNA
    ref     1018694 A       T       DNA
mykrobe variants make-probes --db_name :db_name -f variants.txt ref.fa > variant_probe_set.fa
Build a variant probe set defined based on gene co-ordinates (1-based)

You can also define your variants in terms of gene coordinates in amino acid or DNA space.

    rpoB    S431X   PROT
    rpoB    F425X   PROT
    embB    M306X   PROT
    rrs     C513X   DNA
    gyrA    D94X    PROT
    gid     P75L    PROT
    gid     V88A    PROT
    katG    S315X   PROT

To do this you must provide a genbank file defining the position of the variants in the reference (-g (GENBANK) )

mykrobe variants  make-probes --db_name :db_name -f aa_variants.txt -g ref.gb  ref.fa> gene_variant_probe_set.fa

Citation

Bradley, Phelim, et al. "Rapid antibiotic-resistance predictions from genome sequence data for Staphylococcus aureus and Mycobacterium tuberculosis."Nature communications 6 (2015).

Please cite us if you use Mykrobe predictor in a publication

Tests

To run tests:

Requires mongod. Download.

mongod

and in another window.

  pip install tox
  tox

To run tests for a particular python version run, e.g. python 3.6:

tox -e py36

Release

See dist/README.md

About

Antibiotic resistance prediction in minutes

Resources

License

Stars

Watchers

Forks

Packages

No packages published

Languages

  • Python 95.7%
  • Jupyter Notebook 4.3%