Table of Contents generated with DocToc
- Mykrobe
- Citation
- Tests
- Release
- python > 3.4
- mongodb > 3.0 (optional)
To install mykrobe into a virtual environment (recommended) with pipenv,
run the following
git clone https://github.com/Mykrobe-tools/mykrobe.git mykrobe
cd mykrobe
## Download pre-built probesets
wget -O mykrobe-data.tar.gz https://bit.ly/2H9HKTU && tar -zxvf mykrobe-data.tar.gz && rm -fr src/mykrobe/data && mv mykrobe-data src/mykrobe/data
pipenv install -e . # install mykrobe in a new virtual environment
pipenv shell # enter the virtual environment
mykrobe --help # mykrobe should now be available on pathBefore attempting to install with bioconda, please ensure you have your channels set up
as specified in the documentation. If you don't, you may run into
issues with an older version of mykrobe being installed.
To install this package with conda in a dedicated environment:
conda install -c bioconda mykrobeBiocontainers maintain images for all bioconda recipes. The container
and all tags for mykrobe can be found here. To use a specific version,
just select your required version/tag and use the URI as follows.
tag="0.7.0--py37h2666aa9_0"
uri="quay.io/biocontainers/mykrobe:${tag}"
# using Singularity
singularity exec docker://"$uri" mykrobe --help
# using docker
docker pull "$uri"git clone https://github.com/Mykrobe-tools/mykrobe.git mykrobe
cd mykrobe
## Download pre-built probesets
wget -O mykrobe-data.tar.gz https://bit.ly/2H9HKTU && tar -zxvf mykrobe-data.tar.gz && rm -fr src/mykrobe/data && mv mykrobe-data src/mykrobe/data
pip3 install .Note: It is recommended you install inside a virtual environment. If you choose not to, you will need to run the pip3 install command with sudo. This is because it attempts to put some binaries inside /usr/local/bin if the installation is not being run from inside a virtual environment.
mykrobe --help
usage: mykrobe [-h] [--version]
{predict,panels,variants,vars,genotype} ...
optional arguments:
-h, --help show this help message and exit
--version mykrobe version
[sub-commands]:
{predict,panels,variants,vars,genotype}
predict predict the sample's drug susceptibility
panels A description of the AMR panels available within
Mykrobe predict
variants (vars) build variant probes
genotype genotype a sample using a probe set
mykrobe predict --help
usage: mykrobe predict [-h] [-k kmer] [--tmp TMP] [--keep_tmp]
[--skeleton_dir SKELETON_DIR]
[--mccortex31_path MCCORTEX31_PATH] [-t THREADS]
[-m MEMORY] [--expected_depth EXPECTED_DEPTH]
[-1 seq [seq ...]] [-c ctx] [-f] [--ont]
[--guess_sequence_method] [--ignore_minor_calls]
[--ignore_filtered IGNORE_FILTERED]
[--model model] [--ploidy ploidy]
[--filters FILTERS [FILTERS ...]]
[--report_all_calls]
[--expected_error_rate EXPECTED_ERROR_RATE]
[--min_variant_conf MIN_VARIANT_CONF]
[--min_gene_conf MIN_GENE_CONF]
[--min_proportion_expected_depth MIN_PROPORTION_EXPECTED_DEPTH]
[--min_gene_percent_covg_threshold MIN_GENE_PERCENT_COVG_THRESHOLD]
[--output OUTPUT] [-q] [--panel panel]
[--custom_probe_set_path custom_probe_set_path]
[--custom_variant_to_resistance_json custom_variant_to_resistance_json]
[--min_depth min_depth]
[--conf_percent_cutoff conf_percent_cutoff]
[--format {json,csv}]
sample species
positional arguments:
sample sample id
species species
optional arguments:
-h, --help show this help message and exit
-k kmer, --kmer kmer kmer length (default:21)
--tmp TMP tmp directory (default: tmp/)
--keep_tmp Dont remove tmp files
--skeleton_dir SKELETON_DIR
directory for skeleton binaries
--mccortex31_path MCCORTEX31_PATH
Path to mccortex31. Default mccortex31
-t THREADS, --threads THREADS
threads
-m MEMORY, --memory MEMORY
memory for graph constuction
--expected_depth EXPECTED_DEPTH
expected depth
-1 seq [seq ...], --seq seq [seq ...]
sequence files (fasta,fastq,bam)
-c ctx, --ctx ctx cortex graph binary
-f, --force force
--ont Set default for ONT data. Sets expected_error_rate to
0.15 and to haploid
--guess_sequence_method
Guess if ONT or Illumia based on error rate. If error
rate is > 10%, ploidy is set to haploid and a
confidence threshold is used
--ignore_minor_calls Ignore minor calls when running resistance prediction
--ignore_filtered IGNORE_FILTERED
don't include filtered genotypes
--model model Genotype model used, default kmer_count. Options
kmer_count, median_depth
--ploidy ploidy Use a diploid (includes 0/1 calls) or haploid
genotyping model
--filters FILTERS [FILTERS ...]
don't include filtered genotypes
--report_all_calls report all calls
--expected_error_rate EXPECTED_ERROR_RATE
Expected sequencing error rate. Set to 0.15 for ONT
genotyping.
--min_variant_conf MIN_VARIANT_CONF
minimum genotype confidence for variant genotyping
--min_gene_conf MIN_GENE_CONF
minimum genotype confidence for gene genotyping
--min_proportion_expected_depth MIN_PROPORTION_EXPECTED_DEPTH
minimum depth required on the sum of both alleles.
Default 0.3 (30%)
--min_gene_percent_covg_threshold MIN_GENE_PERCENT_COVG_THRESHOLD
all genes alleles found above this percent coverage
will be reported (default 100 (only best alleles
reported))
--output OUTPUT File path to save output json file as. Default is to
stdout.
-q, --quiet do not output warnings to stderr
--panel panel variant panel (default:201901). custom requires
custom_probe_set_path and
custom_variant_to_resistance_json to be set
--custom_probe_set_path custom_probe_set_path
For use with `--panel custom`. File path to fasta file
from `mykrobe make-probes`.
--custom_variant_to_resistance_json custom_variant_to_resistance_json
For use with `--panel custom`. File path to JSON with
key,value pairs of variant names and induced drug
resistance.
--min_depth min_depth
min_depth
--conf_percent_cutoff conf_percent_cutoff
Number between 0 and 100. Determines
--min_variant_conf, by simulating variants and
choosing the cutoff that would keep x% of the
variants. Default is 90 if --ont, otherwise
--min_variant_conf is used as the cutoff
--format {json,csv} Choose output format. Default: csv.
mykrobe predict tb_sample_id tb -1 tb_sequence.bam/fq --format json --output results.json
# send output to stdout instead
mykrobe predict staph_sample_id staph -1 staph_sequence.bam/fq > result.csvOutput is in CSV by default. For a more detailed output use the JSON format with --format json.
{
"sample_id": {
"susceptibility": {
"Rifampicin": {
"predict": "S"
},
...
"Streptomycin": {
"predict": "S"
}
"phylogenetics": {
"lineage": {
"Unknown": {
"percent_coverage": -1,
"median_depth": -1
}
},
...
"species": {
"Mycobacterium_tuberculosis": {
"percent_coverage": 98.0,
"median_depth": 53
}
}
},
"typed_variants": {
"rpoB_N438S-AAC761118AGT": {
"info": {
"contamination_depths": [],
"coverage": {
"alternate": {
"percent_coverage": 47.62,
"median_depth": 0.0,
"min_depth": 0
},
"reference": {
"percent_coverage": 100.0,
"median_depth": 49.0,
"min_depth": 44.0
}
},
"expected_depths": [
56.0
]
},
"_cls": "Call.VariantCall",
"genotype": [
0,
0
],
"genotype_likelihoods": [
-4.25684443365591,
-99999999.0,
-99999999.0
]
}, ...
},
If you use one of the following panels please cite the relevant publications:
mykrobe predict tb_sample_id tb --panel walker-2015 -1 tb_sequence.bamWalker, Timothy M., et al. "Whole-genome sequencing for prediction of Mycobacterium tuberculosis drug susceptibility and resistance: a retrospective cohort study." The Lancet Infectious Diseases 15.10 (2015): 1193-1202.
mykrobe predict tb_sample_id tb --panel bradley-2015 -1 tb_sequence.bamBradley, Phelim, et al. "Rapid antibiotic-resistance predictions from genome sequence data for Staphylococcus aureus and Mycobacterium tuberculosis." Nature communications 6 (2015).
mykrobe genotype --help
usage: mykrobe genotype [-h] [-k kmer] [--tmp TMP] [--keep_tmp]
[--skeleton_dir SKELETON_DIR]
[--mccortex31_path MCCORTEX31_PATH] [-t THREADS]
[-m MEMORY] [--expected_depth EXPECTED_DEPTH]
[-1 seq [seq ...]] [-c ctx] [-f] [--ont]
[--guess_sequence_method] [--ignore_minor_calls]
[--ignore_filtered IGNORE_FILTERED]
[--model model] [--ploidy ploidy]
[--filters FILTERS [FILTERS ...]]
[--report_all_calls]
[--expected_error_rate EXPECTED_ERROR_RATE]
[--min_variant_conf MIN_VARIANT_CONF]
[--min_gene_conf MIN_GENE_CONF]
[--min_proportion_expected_depth MIN_PROPORTION_EXPECTED_DEPTH]
[--min_gene_percent_covg_threshold MIN_GENE_PERCENT_COVG_THRESHOLD]
[--output OUTPUT] [-q]
sample probe_set
positional arguments:
sample sample id
probe_set probe_set
optional arguments:
-h, --help show this help message and exit
-k kmer, --kmer kmer kmer length (default:21)
--tmp TMP tmp directory (default: tmp/)
--keep_tmp Dont remove tmp files
--skeleton_dir SKELETON_DIR
directory for skeleton binaries
--mccortex31_path MCCORTEX31_PATH
Path to mccortex31. Default mccortex31
-t THREADS, --threads THREADS
threads
-m MEMORY, --memory MEMORY
memory for graph constuction
--expected_depth EXPECTED_DEPTH
expected depth
-1 seq [seq ...], --seq seq [seq ...]
sequence files (fasta,fastq,bam)
-c ctx, --ctx ctx cortex graph binary
-f, --force force
--ont Set demykrobe genotype --help
usage: mykrobe genotype [-h] [-k kmer] [--tmp TMP] [--keep_tmp]
[--skeleton_dir SKELETON_DIR]
[--mccortex31_path MCCORTEX31_PATH] [-t THREADS]
[-m MEMORY] [--expected_depth EXPECTED_DEPTH]
[-1 seq [seq ...]] [-c ctx] [-f] [--ont]
[--guess_sequence_method] [--ignore_minor_calls]
[--ignore_filtered IGNORE_FILTERED]
[--model model] [--ploidy ploidy]
[--filters FILTERS [FILTERS ...]]
[--report_all_calls]
[--expected_error_rate EXPECTED_ERROR_RATE]
[--min_variant_conf MIN_VARIANT_CONF]
[--min_gene_conf MIN_GENE_CONF]
[--min_proportion_expected_depth MIN_PROPORTION_EXPECTED_DEPTH]
[--min_gene_percent_covg_threshold MIN_GENE_PERCENT_COVG_THRESHOLD]
[--output OUTPUT] [-q]
sample probe_set
positional arguments:
sample sample id
probe_set probe_set
optional arguments:
-h, --help show this help message and exit
-k kmer, --kmer kmer kmer length (default:21)
--tmp TMP tmp directory (default: tmp/)
--keep_tmp Dont remove tmp files
--skeleton_dir SKELETON_DIR
directory for skeleton binaries
--mccortex31_path MCCORTEX31_PATH
Path to mccortex31. Default mccortex31
-t THREADS, --threads THREADS
threads
-m MEMORY, --memory MEMORY
memory for graph constuction
--expected_depth EXPECTED_DEPTH
expected depth
-1 seq [seq ...], --seq seq [seq ...]
sequence files (fasta,fastq,bam)
-c ctx, --ctx ctx cortex graph binary
-f, --force force
--ont Set default for ONT data. Sets expected_error_rate to
0.15 and to haploid
--guess_sequence_method
Guess if ONT or Illumia based on error rate. If error
rate is > 10%, ploidy is set to haploid and a
confidence threshold is used
--ignore_minor_calls Ignore minor calls when running resistance prediction
--ignore_filtered IGNORE_FILTERED
don't include filtered genotypes
--model model Genotype model used, default kmer_count. Options
kmer_count, median_depth
--ploidy ploidy Use a diploid (includes 0/1 calls) or haploid
genotyping model
--filters FILTERS [FILTERS ...]
don't include filtered genotypes
--report_all_calls report all calls
--expected_error_rate EXPECTED_ERROR_RATE
Expected sequencing error rate. Set to 0.15 for ONT
genotyping.
--min_variant_conf MIN_VARIANT_CONF
minimum genotype confidence for variant genotyping
--min_gene_conf MIN_GENE_CONF
minimum genotype confidence for gene genotyping
--min_proportion_expected_depth MIN_PROPORTION_EXPECTED_DEPTH
minimum depth required on the sum of both alleles.
Default 0.3 (30%)
--min_gene_percent_covg_threshold MIN_GENE_PERCENT_COVG_THRESHOLD
all genes alleles found above this percent coverage
will be reported (default 100 (only best alleles
reported))
--output OUTPUT File path to save output json file as. Default is to
stdout.
-q, --quiet do not output warnings to stderrfault for ONT data. Sets expected_error_rate to
0.15 and to haploid
--guess_sequence_method
Guess if ONT or Illumia based on error rate. If error
rate is > 10%, ploidy is set to haploid and a
confidence threshold is used
--ignore_minor_calls Ignore minor calls when running resistance prediction
--ignore_filtered IGNORE_FILTERED
don't include filtered genotypes
--model model Genotype model used, default kmer_count. Options
kmer_count, median_depth
--ploidy ploidy Use a diploid (includes 0/1 calls) or haploid
genotyping model
--filters FILTERS [FILTERS ...]
don't include filtered genotypes
--report_all_calls report all calls
--expected_error_rate EXPECTED_ERROR_RATE
Expected sequencing error rate. Set to 0.15 for ONT
genotyping.
--min_variant_conf MIN_VARIANT_CONF
minimum genotype confidence for variant genotyping
--min_gene_conf MIN_GENE_CONF
minimum genotype confidence for gene genotyping
--min_proportion_expected_depth MIN_PROPORTION_EXPECTED_DEPTH
minimum depth required on the sum of both alleles.
Default 0.3 (30%)
--min_gene_percent_covg_threshold MIN_GENE_PERCENT_COVG_THRESHOLD
all genes alleles found above this percent coverage
will be reported (default 100 (only best alleles
reported))
--output OUTPUT File path to save output json file as. Default is to
stdout.
-q, --quiet do not output warnings to stderr
mykrobe genotype sample_id example-data/staph-amr-bradley_2015.fasta -1 seq.fq
{
"sample_id": {
"files": [
"seq.fq "
],
"kmer": 21,
"sequence_calls": {
"mecA": {
"info": {
"copy_number": 0.0,
"contamination_depths": [],
"coverage": {
"percent_coverage": 0.0,
"median_depth": 0.0,
"min_non_zero_depth": 0.0
},
"expected_depths": [
1
]
},
"_cls": "Call.SequenceCall",
"genotype": [
0,
0
],
"genotype_likelihoods": [
-0.001,
-99999999.0,
-99999999.0
]
},
"fusA": {
"info": {
"copy_number": 1.0276923076923077,
"contamination_depths": [],
"version": "10",
"coverage": {
"percent_coverage": 100.0,
"median_depth": 167.0,
"min_non_zero_depth": 116.0
},
"expected_depths": [
162.5
]
},
"_cls": "Call.SequenceCall",
"genotype": [
1,
1
],
"genotype_likelihoods": [
-994.7978064088725,
-349.45246450237215,
-10.95808091830304
]
},
....
}
}
This is optional but will make any probe sets built more robust to variation in within k-1 bases of the key variants. This will require mongoDB > 3.0 running in the background.
usage: mykrobe variants add [-h] [--db_name db_name] [-f] [-q]
[-m METHOD]
vcf reference_set
positional arguments:
vcf a vcf file
reference_set reference set
optional arguments:
-h, --help show this help message and exit
--db_name db_name db_name
-f, --force force
-q, --quiet do not output warnings to stderr
-m METHOD, --method METHOD
variant caller method (e.g. CORTEX)
To add a VCF to the database db_name run
mykrobe variants add --db_name :db_name sample.vcf :referenceUse the --method argument to specify the variant caller or pipeline used (if you'll have multiple Call Sets per sample)
mykrobe variants add --db_name :db_name --method CORTEX sample_cortex.vcf :reference mykrobe variants make-probes --help
usage: mykrobe variants make-probes [-h] [--db_name db_name] [-q]
[-f VCF] [-v VARIANT] [-t TEXT_FILE]
[-g GENBANK] [-k KMER]
[--no-backgrounds]
reference_filepath
positional arguments:
reference_filepath reference_filepath
optional arguments:
-h, --help show this help message and exit
--db_name db_name db_name
-q, --quiet do not output warnings to stderr
-f VCF, --vcf VCF Use variants defined in a VCF file
-v VARIANT, --variant VARIANT
Variant in DNA positions e.g. A1234T
-t TEXT_FILE, --text_file TEXT_FILE
Text file containing variants as rows A1234T
-g GENBANK, --genbank GENBANK
Genbank file containing genes as features
-k KMER, --kmer KMER kmer length
--no-backgrounds Build probe set against reference only ignoring nearby
variants
mykrobe variants make-probes -v A1234T example-data/NC_000962.3.fasta
To build a ProbeSet of all non-singleton variants in the database run:
`mykrobe variants dump-probes`
usage: mykrobe dump-probes [-h] [--db_name db_name] [-q] [--kmer kmer] [--force]
[-v]
reference_filepath
positional arguments:
reference_filepath reference_filepath
optional arguments:
-h, --help show this help message and exit
--db_name db_name db_name
-q, --quiet do not output warnings to stderr
--kmer kmer kmer length
--force
-v, --verbose
mykrobe variants dump-probes reference_set.fasta > variant_probe_set.fastaThis will generate a probe set for each variant in the database. The resulting fasta file will look like the following:
>ref-37d2eea6a23d526cbee4e00b901dc97885a88e7aa8721432b080dcc342b459ce?num_alts=10&ref=56cf2e4ca9fefcd2b15de4d6
TCGCCGCAGCGGTTGGCAACGATGTGGTGCGATCGCTAAAGATCACCGGGCCGGCGGCACCAT
...
TCGCCGCAGCGGTTGGCAACGATGTGGTGCAATCGCTAAAGATCACCGGGCCGGCGGCATCAT
>alt-37d2eea6a23d526cbee4e00b901dc97885a88e7aa8721432b080dcc342b459ce
TCGCCGCAGCGGTTGGCAACGATGTGGTGCAATCGCTAAAGATCACCGGGCCGGCGGCACGAT
>ref-2dab6387a677ac17f6bc181f47235a4196885723b34ceff3a05ffcbfd6834347?num_alts=10&ref=56cf2e4ca9fefcd2b15de4d6
CTGTCGCTGGGAAGAGCGAATACGTCTGGACCAGGACGGGCTACCCGAACACGATATCTTTCG
>alt-2dab6387a677ac17f6bc181f47235a4196885723b34ceff3a05ffcbfd6834347
...
Where you have a series of variants represented as a set of alleles. The reference allele followed by multiple alternate alleles. You will end up with multiple alternate alleles if there are other variants that fall within k of the target variant.
Each variant is referenced by a var_hash with is the hash of ":ref:pos:alt" which is indexed in the database and can be used to query for Variant object.
See mykrobe genotype to use these probes to genotype a new sample.
mykrobe variants make-probes allows you to build a probe set using Variants that are not already in the database but using the population variation to produce multiple alleles per variant.
usage: mykrobe variants make-probes [-h] [--db_name db_name] [-q] [-v VARIANT] [-f FILE]
[-g GENBANK] [-k KMER] [--no-backgrounds]
reference_filepath
positional arguments:
reference_filepath reference_filepath
optional arguments:
-h, --help show this help message and exit
--db_name db_name db_name
-q, --quiet do not output warnings to stderr
-v VARIANT, --variant VARIANT
Variant in DNA positions e.g. A1234T
-f FILE, --file FILE File containing variants as rows A1234T
-g GENBANK, --genbank GENBANK
Genbank file containing genes as features
-k KMER, --kmer KMER kmer length
--no-backgrounds Build probe set against reference only ignoring nearby
variants
First, define your variants for which you want to build probes. Columns are
ref/gene pos ref alt alphabet
ref 2522798 G T DNA
ref 3785555 A G DNA
ref 839793 C A DNA
ref 2734398 C G DNA
ref 3230861 T A DNA
ref 1018694 A T DNA
mykrobe variants make-probes --db_name :db_name -f variants.txt ref.fa > variant_probe_set.fa
You can also define your variants in terms of gene coordinates in amino acid or DNA space.
rpoB S431X PROT
rpoB F425X PROT
embB M306X PROT
rrs C513X DNA
gyrA D94X PROT
gid P75L PROT
gid V88A PROT
katG S315X PROT
To do this you must provide a genbank file defining the position of the variants in the reference (-g (GENBANK) )
mykrobe variants make-probes --db_name :db_name -f aa_variants.txt -g ref.gb ref.fa> gene_variant_probe_set.fa
Please cite us if you use Mykrobe predictor in a publication
To run tests:
Requires mongod. Download.
mongod
and in another window.
pip install tox
tox
To run tests for a particular python version run, e.g. python 3.6:
tox -e py36
See dist/README.md