Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Jump to bottom

Improved error reporting for malformed paired-end reads #97

Open
ConstantinoSchillebeeckx opened this issue Apr 24, 2018 · 0 comments
Open

Improved error reporting for malformed paired-end reads #97

ConstantinoSchillebeeckx opened this issue Apr 24, 2018 · 0 comments

Comments

@ConstantinoSchillebeeckx
Copy link

ConstantinoSchillebeeckx commented Apr 24, 2018 •
edited by Mestabrook3
Loading

Bug Description
I was getting unhelpful error messages after running DADA2 with paired-end reads that were trimmed and oriented manually with an in-house script; see conversation here.

Steps to Reproduce Behavior
You can find a toy dataset that reproduces this error here. Note that in this dataset, the primer in the forward read (GTGCCAGCAGCCGCGGTAA) is present, whereas the primer in the R2 read (GGACTACCAGGGTATCTAAT) is not.
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Assignees
No one assigned
Labels
None yet
Projects
None yet
Milestone
No milestone
Development

No branches or pull requests
1 participant
@ConstantinoSchillebeeckx