Release PR for 3.0.3 #656

jfy133 · 2024-08-22T13:34:02Z

Patch release for a variety of bugs:

#648 - Fix sample ID/assembly ID check failure when no IDs match (reported by @zackhenny, fix by @prototaxites)
#646 - GTDB-Tk directory input now creates a value channel so it runs for all entries to the process and not just the first (reported by @amizeranschi, fix by @prototaxites).
#639 - Fix pipeline failure when a sample produces only a single bin (fix by @d-callan)
#651 - Replace base container for bash only modules to reduce number of containers in pipeline (reported and fixed by @harper357)
#652 - Fix documentation typo in using user-defined assembly parameters (reported and fixed by @amizeranschi)
#653 - Fix overwriting of per-bin 'raw' GUNC RUN output files (multi-bin summary tables not affected) (reported by @zackhenny and fixed by @jfy133)

PR checklist

Post release version bump

Fix GTDB-Tk directory input

Co-authored-by: James A. Fellows Yates <[email protected]>

Fix match check of assembly and sample IDs

Fix #638 [MAG_DEPTHS_PLOT fails if only a single bin is produced]

Remove "=" sign from parameter value assignment

Update nextflow_schema.json

Change unnecessary MultiQC containers to nf-core/ubuntu:20.04

Fix gunc overwriting of raw and checkm files

Remove unused module

Bump versions for release

github-actions · 2024-08-22T13:36:48Z

`nf-core lint` overall result: Passed ✅ ⚠️

Posted for pipeline commit f629418

+| ✅ 305 tests passed       |+
#| ❔   2 tests were ignored |#
!| ❗   6 tests had warnings |!

❗ Test warnings:

nextflow_config - Config manifest.version should end in dev: 3.0.3
pipeline_todos - TODO string in main.nf: Remove this line if you don't need a FASTA file [TODO: try and test using for --host_fasta and --host_genome]
pipeline_todos - TODO string in main.nf: Optionally add in-text citation tools to this list.
pipeline_todos - TODO string in main.nf: Optionally add bibliographic entries to this list.
pipeline_todos - TODO string in main.nf: Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled!
pipeline_todos - TODO string in methods_description_template.yml: #Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline

❔ Tests ignored:

nextflow_config - Config default ignored: params.phix_reference
nextflow_config - Config default ignored: params.lambda_reference

✅ Tests passed:

files_exist - File found: .gitattributes
files_exist - File found: .gitignore
files_exist - File found: .nf-core.yml
files_exist - File found: .editorconfig
files_exist - File found: .prettierignore
files_exist - File found: .prettierrc.yml
files_exist - File found: CHANGELOG.md
files_exist - File found: CITATIONS.md
files_exist - File found: CODE_OF_CONDUCT.md
files_exist - File found: LICENSE or LICENSE.md or LICENCE or LICENCE.md
files_exist - File found: nextflow_schema.json
files_exist - File found: nextflow.config
files_exist - File found: README.md
files_exist - File found: .github/.dockstore.yml
files_exist - File found: .github/CONTRIBUTING.md
files_exist - File found: .github/ISSUE_TEMPLATE/bug_report.yml
files_exist - File found: .github/ISSUE_TEMPLATE/config.yml
files_exist - File found: .github/ISSUE_TEMPLATE/feature_request.yml
files_exist - File found: .github/PULL_REQUEST_TEMPLATE.md
files_exist - File found: .github/workflows/branch.yml
files_exist - File found: .github/workflows/ci.yml
files_exist - File found: .github/workflows/linting_comment.yml
files_exist - File found: .github/workflows/linting.yml
files_exist - File found: assets/email_template.html
files_exist - File found: assets/email_template.txt
files_exist - File found: assets/sendmail_template.txt
files_exist - File found: assets/nf-core-mag_logo_light.png
files_exist - File found: conf/modules.config
files_exist - File found: conf/test.config
files_exist - File found: conf/test_full.config
files_exist - File found: docs/images/nf-core-mag_logo_light.png
files_exist - File found: docs/images/nf-core-mag_logo_dark.png
files_exist - File found: docs/output.md
files_exist - File found: docs/README.md
files_exist - File found: docs/README.md
files_exist - File found: docs/usage.md
files_exist - File found: main.nf
files_exist - File found: assets/multiqc_config.yml
files_exist - File found: conf/base.config
files_exist - File found: conf/igenomes.config
files_exist - File found: .github/workflows/awstest.yml
files_exist - File found: .github/workflows/awsfulltest.yml
files_exist - File found: modules.json
files_exist - File not found check: .github/ISSUE_TEMPLATE/bug_report.md
files_exist - File not found check: .github/ISSUE_TEMPLATE/feature_request.md
files_exist - File not found check: .github/workflows/push_dockerhub.yml
files_exist - File not found check: .markdownlint.yml
files_exist - File not found check: .nf-core.yaml
files_exist - File not found check: .yamllint.yml
files_exist - File not found check: bin/markdown_to_html.r
files_exist - File not found check: conf/aws.config
files_exist - File not found check: docs/images/nf-core-mag_logo.png
files_exist - File not found check: lib/Checks.groovy
files_exist - File not found check: lib/Completion.groovy
files_exist - File not found check: lib/NfcoreTemplate.groovy
files_exist - File not found check: lib/Utils.groovy
files_exist - File not found check: lib/Workflow.groovy
files_exist - File not found check: lib/WorkflowMain.groovy
files_exist - File not found check: lib/WorkflowMag.groovy
files_exist - File not found check: parameters.settings.json
files_exist - File not found check: pipeline_template.yml
files_exist - File not found check: Singularity
files_exist - File not found check: lib/nfcore_external_java_deps.jar
files_exist - File not found check: .travis.yml
nextflow_config - Config variable found: manifest.name
nextflow_config - Config variable found: manifest.nextflowVersion
nextflow_config - Config variable found: manifest.description
nextflow_config - Config variable found: manifest.version
nextflow_config - Config variable found: manifest.homePage
nextflow_config - Config variable found: timeline.enabled
nextflow_config - Config variable found: trace.enabled
nextflow_config - Config variable found: report.enabled
nextflow_config - Config variable found: dag.enabled
nextflow_config - Config variable found: process.cpus
nextflow_config - Config variable found: process.memory
nextflow_config - Config variable found: process.time
nextflow_config - Config variable found: params.outdir
nextflow_config - Config variable found: params.input
nextflow_config - Config variable found: params.validationShowHiddenParams
nextflow_config - Config variable found: params.validationSchemaIgnoreParams
nextflow_config - Config variable found: manifest.mainScript
nextflow_config - Config variable found: timeline.file
nextflow_config - Config variable found: trace.file
nextflow_config - Config variable found: report.file
nextflow_config - Config variable found: dag.file
nextflow_config - Config variable (correctly) not found: params.nf_required_version
nextflow_config - Config variable (correctly) not found: params.container
nextflow_config - Config variable (correctly) not found: params.singleEnd
nextflow_config - Config variable (correctly) not found: params.igenomesIgnore
nextflow_config - Config variable (correctly) not found: params.name
nextflow_config - Config variable (correctly) not found: params.enable_conda
nextflow_config - Config timeline.enabled had correct value: true
nextflow_config - Config report.enabled had correct value: true
nextflow_config - Config trace.enabled had correct value: true
nextflow_config - Config dag.enabled had correct value: true
nextflow_config - Config manifest.name began with nf-core/
nextflow_config - Config variable manifest.homePage began with https://github.com/nf-core/
nextflow_config - Config dag.file ended with .html
nextflow_config - Config variable manifest.nextflowVersion started with >= or !>=
nextflow_config - Config params.custom_config_version is set to master
nextflow_config - Config params.custom_config_base is set to https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Lines for loading custom profiles found
nextflow_config - nextflow.config contains configuration profile test
nextflow_config - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/
nextflow_config - Config default value correct: params.custom_config_version= master
nextflow_config - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Config default value correct: params.max_cpus= 16
nextflow_config - Config default value correct: params.max_memory= 128.GB
nextflow_config - Config default value correct: params.max_time= 240.h
nextflow_config - Config default value correct: params.publish_dir_mode= copy
nextflow_config - Config default value correct: params.max_multiqc_email_size= 25.MB
nextflow_config - Config default value correct: params.validate_params= true
nextflow_config - Config default value correct: params.pipelines_testdata_base_path= https://raw.githubusercontent.com/nf-core/test-datasets/
nextflow_config - Config default value correct: params.spades_fix_cpus= -1
nextflow_config - Config default value correct: params.spadeshybrid_fix_cpus= -1
nextflow_config - Config default value correct: params.metabat_rng_seed= 1
nextflow_config - Config default value correct: params.clip_tool= fastp
nextflow_config - Config default value correct: params.reads_minlength= 15
nextflow_config - Config default value correct: params.fastp_qualified_quality= 15
nextflow_config - Config default value correct: params.fastp_cut_mean_quality= 15
nextflow_config - Config default value correct: params.adapterremoval_minquality= 2
nextflow_config - Config default value correct: params.adapterremoval_adapter1= AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
nextflow_config - Config default value correct: params.adapterremoval_adapter2= AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
nextflow_config - Config default value correct: params.bbnorm_target= 100
nextflow_config - Config default value correct: params.bbnorm_min= 5
nextflow_config - Config default value correct: params.longreads_min_length= 1000
nextflow_config - Config default value correct: params.longreads_keep_percent= 90
nextflow_config - Config default value correct: params.longreads_length_weight= 10
nextflow_config - Config default value correct: params.gtdb_db= https://data.ace.uq.edu.au/public/gtdb/data/releases/release214/214.1/auxillary_files/gtdbtk_r214_data.tar.gz
nextflow_config - Config default value correct: params.gtdbtk_min_completeness= 50.0
nextflow_config - Config default value correct: params.gtdbtk_max_contamination= 10.0
nextflow_config - Config default value correct: params.gtdbtk_min_perc_aa= 10.0
nextflow_config - Config default value correct: params.gtdbtk_min_af= 0.65
nextflow_config - Config default value correct: params.gtdbtk_pplacer_cpus= 1.0
nextflow_config - Config default value correct: params.gtdbtk_pplacer_scratch= true
nextflow_config - Config default value correct: params.genomad_min_score= 0.7
nextflow_config - Config default value correct: params.genomad_splits= 1
nextflow_config - Config default value correct: params.binning_map_mode= group
nextflow_config - Config default value correct: params.min_contig_size= 1500
nextflow_config - Config default value correct: params.min_length_unbinned_contigs= 1000000
nextflow_config - Config default value correct: params.max_unbinned_contigs= 100
nextflow_config - Config default value correct: params.bin_domain_classification_tool= tiara
nextflow_config - Config default value correct: params.tiara_min_length= 3000
nextflow_config - Config default value correct: params.binqc_tool= busco
nextflow_config - Config default value correct: params.checkm_download_url= https://data.ace.uq.edu.au/public/CheckM_databases/checkm_data_2015_01_16.tar.gz
nextflow_config - Config default value correct: params.refine_bins_dastool_threshold= 0.5
nextflow_config - Config default value correct: params.postbinning_input= raw_bins_only
nextflow_config - Config default value correct: params.gunc_database_type= progenomes
nextflow_config - Config default value correct: params.pydamage_accuracy= 0.5
nextflow_config - Config default value correct: params.freebayes_ploidy= 1
nextflow_config - Config default value correct: params.freebayes_min_basequality= 20
nextflow_config - Config default value correct: params.freebayes_minallelefreq= 0.33
nextflow_config - Config default value correct: params.bcftools_view_high_variant_quality= 30
nextflow_config - Config default value correct: params.bcftools_view_medium_variant_quality= 20
nextflow_config - Config default value correct: params.bcftools_view_minimal_allelesupport= 3
files_unchanged - .gitattributes matches the template
files_unchanged - .prettierrc.yml matches the template
files_unchanged - CODE_OF_CONDUCT.md matches the template
files_unchanged - LICENSE matches the template
files_unchanged - .github/.dockstore.yml matches the template
files_unchanged - .github/CONTRIBUTING.md matches the template
files_unchanged - .github/ISSUE_TEMPLATE/bug_report.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/config.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/feature_request.yml matches the template
files_unchanged - .github/PULL_REQUEST_TEMPLATE.md matches the template
files_unchanged - .github/workflows/branch.yml matches the template
files_unchanged - .github/workflows/linting_comment.yml matches the template
files_unchanged - .github/workflows/linting.yml matches the template
files_unchanged - assets/email_template.html matches the template
files_unchanged - assets/email_template.txt matches the template
files_unchanged - assets/sendmail_template.txt matches the template
files_unchanged - assets/nf-core-mag_logo_light.png matches the template
files_unchanged - docs/images/nf-core-mag_logo_light.png matches the template
files_unchanged - docs/images/nf-core-mag_logo_dark.png matches the template
files_unchanged - docs/README.md matches the template
files_unchanged - .gitignore matches the template
files_unchanged - .prettierignore matches the template
actions_ci - '.github/workflows/ci.yml' is triggered on expected events
actions_ci - '.github/workflows/ci.yml' checks minimum NF version
actions_awstest - '.github/workflows/awstest.yml' is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml does not use -profile test
readme - README Nextflow minimum version badge matched config. Badge: 23.04.0, Config: 23.04.0
readme - README Zenodo placeholder was replaced with DOI.
pipeline_name_conventions - Name adheres to nf-core convention
template_strings - Did not find any Jinja template strings (319 files)
schema_lint - Schema lint passed
schema_lint - Schema title + description lint passed
schema_lint - Input mimetype lint passed: 'text/csv'
schema_params - Schema matched params returned from nextflow config
system_exit - No System.exit calls found
actions_schema_validation - Workflow validation passed: awstest.yml
actions_schema_validation - Workflow validation passed: branch.yml
actions_schema_validation - Workflow validation passed: fix-linting.yml
actions_schema_validation - Workflow validation passed: linting.yml
actions_schema_validation - Workflow validation passed: clean-up.yml
actions_schema_validation - Workflow validation passed: ci.yml
actions_schema_validation - Workflow validation passed: linting_comment.yml
actions_schema_validation - Workflow validation passed: awsfulltest.yml
actions_schema_validation - Workflow validation passed: download_pipeline.yml
actions_schema_validation - Workflow validation passed: release-announcements.yml
merge_markers - No merge markers found in pipeline files
modules_json - Only installed modules found in modules.json
multiqc_config - assets/multiqc_config.yml found and not ignored.
multiqc_config - assets/multiqc_config.yml contains report_section_order
multiqc_config - assets/multiqc_config.yml contains export_plots
multiqc_config - assets/multiqc_config.yml contains report_comment
multiqc_config - assets/multiqc_config.yml follows the ordering scheme of the minimally required plugins.
multiqc_config - assets/multiqc_config.yml contains a matching 'report_comment'.
multiqc_config - assets/multiqc_config.yml contains 'export_plots: true'.
modules_structure - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL'
base_config - conf/base.config found and not ignored.
base_config - BOWTIE2_HOST_REMOVAL_BUILD found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
base_config - PORECHOP_PORECHOP found in conf/base.config and Nextflow scripts.
base_config - NANOLYSE found in conf/base.config and Nextflow scripts.
base_config - FILTLONG found in conf/base.config and Nextflow scripts.
base_config - CENTRIFUGE_CENTRIFUGE found in conf/base.config and Nextflow scripts.
base_config - KRAKEN2 found in conf/base.config and Nextflow scripts.
base_config - KRONA_KTIMPORTTAXONOMY found in conf/base.config and Nextflow scripts.
base_config - CAT_DB_GENERATE found in conf/base.config and Nextflow scripts.
base_config - CAT found in conf/base.config and Nextflow scripts.
base_config - GTDBTK_CLASSIFYWF found in conf/base.config and Nextflow scripts.
base_config - MEGAHIT found in conf/base.config and Nextflow scripts.
base_config - SPADES found in conf/base.config and Nextflow scripts.
base_config - SPADESHYBRID found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/base.config and Nextflow scripts.
base_config - METABAT2_METABAT2 found in conf/base.config and Nextflow scripts.
base_config - MAG_DEPTHS found in conf/base.config and Nextflow scripts.
base_config - BUSCO found in conf/base.config and Nextflow scripts.
base_config - MAXBIN2 found in conf/base.config and Nextflow scripts.
base_config - DASTOOL_DASTOOL found in conf/base.config and Nextflow scripts.
modules_config - conf/modules.config found and not ignored.
modules_config - FASTQC_RAW found in conf/modules.config and Nextflow scripts.
modules_config - FASTP found in conf/modules.config and Nextflow scripts.
modules_config - ADAPTERREMOVAL_PE found in conf/modules.config and Nextflow scripts.
modules_config - ADAPTERREMOVAL_SE found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - FASTQC_TRIMMED found in conf/modules.config and Nextflow scripts.
modules_config - BBMAP_BBNORM found in conf/modules.config and Nextflow scripts.
modules_config - PORECHOP_PORECHOP found in conf/modules.config and Nextflow scripts.
modules_config - FILTLONG found in conf/modules.config and Nextflow scripts.
modules_config - NANOLYSE found in conf/modules.config and Nextflow scripts.
modules_config - NANOPLOT_RAW found in conf/modules.config and Nextflow scripts.
modules_config - NANOPLOT_FILTERED found in conf/modules.config and Nextflow scripts.
modules_config - CENTRIFUGE_CENTRIFUGE found in conf/modules.config and Nextflow scripts.
modules_config - CENTRIFUGE_KREPORT found in conf/modules.config and Nextflow scripts.
modules_config - KRAKEN2 found in conf/modules.config and Nextflow scripts.
modules_config - KREPORT2KRONA_CENTRIFUGE found in conf/modules.config and Nextflow scripts.
modules_config - KRONA_KTIMPORTTAXONOMY found in conf/modules.config and Nextflow scripts.
modules_config - MEGAHIT found in conf/modules.config and Nextflow scripts.
modules_config - SPADES found in conf/modules.config and Nextflow scripts.
modules_config - SPADESHYBRID found in conf/modules.config and Nextflow scripts.
modules_config - QUAST found in conf/modules.config and Nextflow scripts.
modules_config - GENOMAD_ENDTOEND found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - MAG_DEPTHS_PLOT found in conf/modules.config and Nextflow scripts.
modules_config - BIN_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_DB_PREPARATION found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_SAVE_DOWNLOAD found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - ARIA2_UNTAR found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM_LINEAGEWF found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM_QA found in conf/modules.config and Nextflow scripts.
modules_config - COMBINE_CHECKM_TSV found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_DOWNLOADDB found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_RUN found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_MERGECHECKM found in conf/modules.config and Nextflow scripts.
modules_config - CAT_DB_GENERATE found in conf/modules.config and Nextflow scripts.
modules_config - CAT found in conf/modules.config and Nextflow scripts.
modules_config - CAT_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - GTDBTK_CLASSIFYWF found in conf/modules.config and Nextflow scripts.
modules_config - GTDBTK_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - PROKKA found in conf/modules.config and Nextflow scripts.
modules_config - PRODIGAL found in conf/modules.config and Nextflow scripts.
modules_config - FREEBAYES found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_VIEW found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_CONSENSUS found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_INDEX found in conf/modules.config and Nextflow scripts.
modules_config - PYDAMAGE_ANALYZE found in conf/modules.config and Nextflow scripts.
modules_config - PYDAMAGE_FILTER found in conf/modules.config and Nextflow scripts.
modules_config - SAMTOOLS_FAIDX found in conf/modules.config and Nextflow scripts.
modules_config - METABAT2_JGISUMMARIZEBAMCONTIGDEPTHS found in conf/modules.config and Nextflow scripts.
modules_config - METABAT2_METABAT2 found in conf/modules.config and Nextflow scripts.
modules_config - MAXBIN2 found in conf/modules.config and Nextflow scripts.
modules_config - ADJUST_MAXBIN2_EXT found in conf/modules.config and Nextflow scripts.
modules_config - CONCOCT_ found in conf/modules.config and Nextflow scripts.
modules_config - SPLIT_FASTA found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_METABAT2 found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_MAXBIN2 found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_CONCOCT found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_TIARA found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_DASTOOL found in conf/modules.config and Nextflow scripts.
modules_config - RENAME_POSTDASTOOL found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_TIARA found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_CLASSIFY found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - MMSEQS_DATABASES found in conf/modules.config and Nextflow scripts.
modules_config - METAEUK_EASYPREDICT found in conf/modules.config and Nextflow scripts.
modules_config - MULTIQC found in conf/modules.config and Nextflow scripts.
nfcore_yml - Repository type in .nf-core.yml is valid: pipeline
nfcore_yml - nf-core version in .nf-core.yml is set to the latest version: 2.14.1

Run details

nf-core/tools version 2.14.1
Run at 2024-08-27 07:54:28

subworkflows/local/depths.nf

CHANGELOG.md

jfy133 and others added 30 commits July 4, 2024 08:41

Post release bump

127e394

Merge pull request #636 from nf-core/postreleasebump

65c4fd8

Post release version bump

only make bin depths plots for cases w >2 samples and >2 bins

3b95035

Update gtdbtk.nf

8082972

Update gtdbtk.nf

deab007

Update CHANGELOG.md

5b9c4f1

Fix code that combines assembly and sample IDs for checking

8f4147f

Update changelog

86412f0

Merge pull request #646 from prototaxites/fix_gtdb_dir_input

a4adc3d

Fix GTDB-Tk directory input

Merge branch 'dev' into fix_match

3668376

Update CHANGELOG.md

f143707

Co-authored-by: James A. Fellows Yates <[email protected]>

Update subworkflows/local/utils_nfcore_mag_pipeline/main.nf

098c192

Co-authored-by: James A. Fellows Yates <[email protected]>

Update CHANGELOG.md

3b509ed

Co-authored-by: James A. Fellows Yates <[email protected]>

Merge pull request #648 from prototaxites/fix_match

6ebc119

Fix match check of assembly and sample IDs

clarify when clustered heatmaps will be produced as outputs

66a0af4

add bug fix 639 to changelog

f7c8aca

[automated] Fix code linting

bd3e813

Merge branch 'dev' into fix-638

6445d78

Add @d-callan and other recent code contributors

83f1fe7

Add other third wave of developer leads to authors

f79135c

[automated] Fix code linting

b708160

Update subworkflows/local/depths.nf

e7ebbfa

Update LICENSE to include more recent contributors

36cfd42

Merge pull request #639 from nf-core/fix-638

171ea0d

Fix #638 [MAG_DEPTHS_PLOT fails if only a single bin is produced]

replaced old MultiQC containers with nf-core/ubuntu:20.04

5851a1d

Update CHANGELOG

bd0ef3b

Update nextflow_schema.json

993ac6d

Remove "=" sign from parameter value assignment

Merge pull request #652 from nf-core/amizeranschi-patch-1

225257b

Update nextflow_schema.json

Merge pull request #651 from harper357/container_sync

6a40905

Change unnecessary MultiQC containers to nf-core/ubuntu:20.04

Fix GUNC overwriting of raw output files

364b3ee

jfy133 added 7 commits August 22, 2024 14:12

Merge pull request #653 from nf-core/fix-gunc-overwriting

dd7ae6c

Fix gunc overwriting of raw and checkm files

Remove unused module

2971376

Fix linting

25ce9b1

Remove reference to CUSTOM_DUMPSOFTWAREVERSONS in base.config

70e647c

Merge pull request #654 from nf-core/remove-old-module

1a425b5

Remove unused module

Dump versions for release

5972c67

Merge pull request #655 from nf-core/bump-version

a3c3471

Bump versions for release

maxulysse approved these changes Aug 22, 2024

View reviewed changes

heuermh approved these changes Aug 22, 2024

View reviewed changes

subworkflows/local/depths.nf Show resolved Hide resolved

jfy133 commented Aug 27, 2024

View reviewed changes

CHANGELOG.md Outdated Show resolved Hide resolved

Update CHANGELOG.md

f629418

jfy133 merged commit 8e3f760 into master Aug 27, 2024
33 checks passed

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Release PR for 3.0.3 #656

Release PR for 3.0.3 #656

jfy133 commented Aug 22, 2024

github-actions bot commented Aug 22, 2024 •

edited

Loading

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

Release PR for 3.0.3 #656

Release PR for 3.0.3 #656

Conversation

jfy133 commented Aug 22, 2024

PR checklist

github-actions bot commented Aug 22, 2024 • edited Loading

nf-core lint overall result: Passed ✅ ⚠️

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

github-actions bot commented Aug 22, 2024 •

edited

Loading

`nf-core lint` overall result: Passed ✅ ⚠️