-
Notifications
You must be signed in to change notification settings - Fork 23
read_454
[read_454] read output from Roche's 454 sequencing platform.
Roche's 454 data comes in two files per data set: Sequence data in a FASTA file and a file with pseudo FASTA entries containing the quality scores as a decimal number in the range 0-40 per base. [read_454] simultaniously read in both files which must have the entries in the same order (default) and the decimal quality scores are encoded in a string of characters (each char = score + 64) similar to Illumina data.
read_454 [options] -i <FASTA file> -q <quality file>
[-? | --help] # Print full usage description.
[-i <file!> | --data_in=<file!>] # FASTA file with sequence data.
[-q <file!] | --qual_in=<file!>] # FASTA file with quality data.
[-n <uint> | --num=<uint>] # Limit number of records to read.
[-I <file!> | --stream_in=<file!>] # Read input stream from file - Default=STDIN
[-O <file> | --stream_out=<file>] # Write output stream to file - Default=STDOUT
[-v | --verbose] # Verbose output.
Consider the following two entries in the files 454.fna and 454.qual, respectively:
>GG42H5Y01A9ZDB rank=0000022 x=406.5 y=2493.0 length=63
ACGTCATGGGCAATCCTGAGCCAACTCATGGAAATGGATAGGTGCAGAGACTCAATGGC
TGAC
>GG42H5Y01A9ZDB rank=0000022 x=406.5 y=2493.0 length=63
40 40 40 40 40 40 40 37 37 34 25 25 25 25 23 23 32 36 40 32 31
31 29 29 33 34 34 34 34 14 14 14 14 14 31 24 24 31 32 25 24 27
26 36 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40
To read in the data use [read_454] like this:
read_454 -i 454.fna -q 454.qual
SCORES: IIIIIIIFFC::::88AEIA@@>>BCCCC/////@99@A:9<;EIIIIIIIIIIIIIIIIIII
SEQ: ACGTCATGGGCAATCCTGAGCCAACTCATGGAAATGGATAGGTGCAGAGACTCAATGGCTGAC
SEQ_LEN: 63
SEQ_NAME: GG42H5Y01A9ZDB rank=0000022 x=406.5 y=2493.0 length=63
---
[write_454]
Martin Asser Hansen - Copyright (C) - All rights reserved.
May 2010
GNU General Public License version 2
http://www.gnu.org/copyleft/gpl.html
[read_454] is part of the Biopieces framework.